ID: 1104894470

View in Genome Browser
Species Human (GRCh38)
Location 12:132155042-132155064
Sequence CTGAAGGGAGACCCGGAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894470_1104894480 30 Left 1104894470 12:132155042-132155064 CCCGATTCCGGGTCTCCCTTCAG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1104894480 12:132155095-132155117 CACAGCTACATCCGTAATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 51
1104894470_1104894474 -10 Left 1104894470 12:132155042-132155064 CCCGATTCCGGGTCTCCCTTCAG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109
1104894470_1104894477 -3 Left 1104894470 12:132155042-132155064 CCCGATTCCGGGTCTCCCTTCAG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894470_1104894479 29 Left 1104894470 12:132155042-132155064 CCCGATTCCGGGTCTCCCTTCAG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1104894479 12:132155094-132155116 TCACAGCTACATCCGTAATGAGG 0: 1
1: 0
2: 0
3: 7
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894470 Original CRISPR CTGAAGGGAGACCCGGAATC GGG (reversed) Intergenic
902043773 1:13510857-13510879 TTGAAGTGAGACCCGCATTCAGG - Intronic
902789955 1:18760920-18760942 CTGAAGGTAGACTGGAAATCAGG + Intergenic
903218916 1:21858077-21858099 CTGAAGGGAGGCCAGGAAGTGGG - Intronic
903419242 1:23206648-23206670 CTGAAGGGTGACTTGGAATTAGG - Intergenic
903959978 1:27050856-27050878 TTTAAGAGAGACCCTGAATCAGG - Intergenic
904128885 1:28260747-28260769 TTGCAGGGAGACCGGGAATTAGG + Intronic
904945049 1:34193098-34193120 GTGGAAGGAGACCCTGAATCAGG + Intronic
905183065 1:36178396-36178418 CTGGAGGGGGATCCGGGATCAGG - Intronic
913044186 1:115059469-115059491 CTGGATGGAGCCCAGGAATCTGG - Intronic
920067130 1:203276921-203276943 TTGAAGGGTGACCCTGAATTGGG - Intergenic
922067103 1:222155002-222155024 CTGAAAGGAGACCTGGAAATAGG + Intergenic
922754989 1:228090745-228090767 CTGCAGGGAGGCCAGGAAACAGG + Intronic
923343284 1:233025496-233025518 CTGAAGGGAGTCGAGGAATCAGG + Intronic
1062898932 10:1126808-1126830 CTGAAGAGACACCCGGTCTCAGG - Intronic
1075175922 10:120160936-120160958 CTGAAGGGTGAGCCGGAGTTAGG + Intergenic
1076467894 10:130697575-130697597 CTGGAGGGAGACCCGATGTCTGG + Intergenic
1076519985 10:131075469-131075491 CTGCACGGAGACCCAGACTCTGG - Intergenic
1077186413 11:1237308-1237330 CTGACGGGAGATCCGGACTTGGG - Intronic
1079505811 11:21150738-21150760 CTGGAGTGAGACCCAGAATTAGG + Intronic
1080283790 11:30586059-30586081 CTGAAGGCATCCCCGGGATCCGG - Intronic
1080924471 11:36741874-36741896 CTAGATGGAGACCCAGAATCTGG - Intergenic
1083626724 11:64075640-64075662 AAGAAGGGGGACCCCGAATCTGG + Intronic
1084388423 11:68859328-68859350 CTGAAAGGAGACCTGAAATGTGG - Intergenic
1084726346 11:70944818-70944840 CGGAAGAGAGCCCTGGAATCAGG - Intronic
1084799513 11:71533212-71533234 GTGAAGGGAGACCCTGTATGGGG + Intronic
1092086834 12:5769590-5769612 AGGTAGGGAGACCTGGAATCAGG - Intronic
1093892986 12:24545847-24545869 CTGAACGGAGACCCAGAGCCAGG - Intergenic
1094132511 12:27089620-27089642 CTGCAGGGAGTCCTGGACTCTGG - Intergenic
1094181987 12:27601627-27601649 CTGCAGGGAGTCCTGGACTCTGG - Intronic
1096510855 12:52127402-52127424 GTGCAGAGAGACCAGGAATCTGG + Intergenic
1097174006 12:57132423-57132445 CTCAAGGGAGACCCAGAATAGGG - Intronic
1103314080 12:120038008-120038030 CTGAAGGGTGACCTGGAAGTGGG + Intronic
1104894470 12:132155042-132155064 CTGAAGGGAGACCCGGAATCGGG - Intergenic
1104990842 12:132623029-132623051 CTGAAGGGAAACCCAGTCTCAGG + Intergenic
1114246704 14:20921052-20921074 TTGAAGGCAGGCCAGGAATCAGG - Intergenic
1115115685 14:29878747-29878769 CTGAAGGGAGGACAGGAATGGGG + Intronic
1115333232 14:32220317-32220339 GTGAAGGGAGACCTGGAAAGAGG - Intergenic
1117297536 14:54393455-54393477 GTGGAGGGAGAGCGGGAATCGGG + Intergenic
1119904757 14:78291569-78291591 CTGTAGGGTGACCAGGAATTTGG - Intronic
1121503530 14:94458995-94459017 CTCAAGGGAGGGCCTGAATCTGG - Intergenic
1125229522 15:37437073-37437095 CTAAAGGGAGAACCTGACTCAGG - Intergenic
1125891316 15:43269121-43269143 CTAAAGGGAGATCAGGAAGCTGG - Intergenic
1129323820 15:74789199-74789221 CTGACGGGAGCCCCGGGATGGGG + Intronic
1130712591 15:86298591-86298613 CTGAAGGGAGGCCTGGAGGCAGG - Intronic
1135665778 16:24334587-24334609 CTGAAGGGAGATCCTAAATGGGG - Intronic
1136451856 16:30358198-30358220 CAGCAAGGAGACCCGGAAGCAGG - Exonic
1145904013 17:28506568-28506590 CTCAAGGGAGACTCAGAATTCGG + Intronic
1146683367 17:34824375-34824397 CTGAAGGGAAGCCCTGAGTCTGG - Intergenic
1146948166 17:36888181-36888203 CTGCAGGGAGACCAGGCCTCTGG + Intergenic
1147328258 17:39680582-39680604 CTGAAGGAGACCCCGGAATCTGG - Intronic
1152287682 17:79422176-79422198 CAGAAGGGAGACAGGGAAACAGG + Intronic
1153678596 18:7478385-7478407 CAGAAGGGAGACATGGTATCAGG + Intergenic
1156779030 18:40828182-40828204 CTGAAGTGAGACCTAGAATCTGG + Intergenic
1157332586 18:46714477-46714499 CTGAAGGGAGGAACGGAGTCTGG + Intronic
1162294824 19:9806091-9806113 CTGAAGGGAGGCCCAGTAACTGG - Intergenic
1163551476 19:17968138-17968160 CAGCAGGGACACCCGGACTCTGG + Intronic
1164698840 19:30267667-30267689 CTGAAGGCAGACAGGGAGTCAGG - Intronic
1167410533 19:49341305-49341327 CTGAAGGGGGACCCCAAAACTGG - Exonic
927702919 2:25279337-25279359 CTGAAAAGAGACCTGGAATAAGG + Intronic
929218409 2:39438888-39438910 CTGAAGGAAGGCCTGTAATCTGG - Intergenic
929451546 2:42041506-42041528 CTGAAAAAAGACCCTGAATCGGG + Intergenic
930047166 2:47182947-47182969 CTGAAGGGAAATCAGGAACCAGG + Intergenic
941080472 2:161054973-161054995 CTGAAGGGAGAACTAGAAGCTGG + Intergenic
948255240 2:236563721-236563743 CCTAAGGGGGTCCCGGAATCTGG - Intergenic
1175212006 20:57365059-57365081 CTGAGAGGAGACCTGGGATCAGG + Intronic
1175262339 20:57682442-57682464 CTCCAGGGAGACCCAGAACCTGG - Intronic
1180741578 22:18056898-18056920 CTGGAGGGAGGCCTGGCATCAGG - Intergenic
1181312805 22:21954546-21954568 CTGGAGTGAGACCAGGAACCTGG + Intergenic
1181345912 22:22220618-22220640 CTGGAGTGAGACCAGGAACCTGG + Intergenic
1183266550 22:36830128-36830150 CTGAAGGGTGAGCAGGTATCAGG + Intergenic
954429967 3:50465409-50465431 GTGCAGGGAGACCCGGAAGCTGG - Intronic
954990846 3:54839619-54839641 CTAAAGGGAGCCCAGGAATCAGG + Intronic
955346898 3:58168077-58168099 CTGGAGGGAGAGCTGGACTCTGG + Intronic
962274739 3:134003504-134003526 CTGCAAGGAGACCTGGAATGGGG - Intronic
967256347 3:187596058-187596080 CGTAAGGGAGACTTGGAATCAGG + Intergenic
968527504 4:1069746-1069768 CTGAAGGGTGACCCATAACCTGG - Intronic
968751150 4:2389712-2389734 CTGCAGGGAGCCCCAGAATGAGG + Intronic
969566901 4:7984159-7984181 CGGAAGGGAGACCCCGTGTCGGG + Intronic
977257711 4:94758484-94758506 CTGAGGGCAGTCGCGGAATCCGG + Intronic
984727875 4:183038632-183038654 CTGAAGGGAGTCCCTGGAGCAGG + Intergenic
990812694 5:59747061-59747083 CTGAAGGGAGATCCAGAAACTGG - Intronic
995321001 5:110833893-110833915 CTGAAGGAAGACATGGAATCTGG - Intergenic
996308341 5:122076847-122076869 CTGAAGGTAGACCGGGGAGCGGG + Intronic
1002448027 5:179301999-179302021 CTGCAGGGAGTCCCGGAGCCTGG - Intronic
1002915288 6:1523983-1524005 CAGGAGGGAGACGCGGACTCGGG - Intergenic
1003256110 6:4476375-4476397 CTGAAGGGGGATGCGGAATTGGG - Intergenic
1004690035 6:17986062-17986084 CTGAAGAGAGACTCTGAAGCAGG - Intronic
1005878423 6:30033899-30033921 TTGGAGGGAGACATGGAATCAGG - Intergenic
1006411278 6:33875282-33875304 CTGAAGCCAAACCCGGAATGTGG + Intergenic
1007502324 6:42307786-42307808 CTGCAGGGAGTCCCAGAACCTGG + Intronic
1010350982 6:74874041-74874063 CTGAAGGAAGTCCTTGAATCTGG + Intergenic
1010724064 6:79313145-79313167 CTCATGGCCGACCCGGAATCAGG + Intergenic
1013734503 6:113209605-113209627 CTGAAGGGTGACCCAGCATCTGG + Intergenic
1015276623 6:131388894-131388916 CTGAAGAGAAAACAGGAATCAGG - Intergenic
1017426639 6:154328805-154328827 CTAAAGTGAGACCGGGAACCTGG - Intronic
1029418263 7:100457079-100457101 CTGATGGGAGAGGTGGAATCAGG - Intronic
1032491728 7:132329031-132329053 CTGGAGGGAGTCCGAGAATCTGG - Intronic
1034983743 7:155494835-155494857 CTCCAGGGAGACCTGGCATCGGG - Intronic
1035839394 8:2794627-2794649 CTGAAGGGAGGCGAGGAAGCTGG + Intergenic
1038023684 8:23571047-23571069 CTGAAGGCAGCCCCCGAACCAGG - Intronic
1038164578 8:25073081-25073103 GTGAAGGGAGACAAGGAATTTGG - Intergenic
1038566520 8:28623500-28623522 CTGCAGGGTGACCCAGAAACAGG - Intronic
1043364803 8:79520552-79520574 CTGAAAGGAGACACGGTTTCAGG - Intergenic
1044384052 8:91566632-91566654 CTGAAGGGAGAGCCTGTGTCAGG - Intergenic
1049435229 8:142583409-142583431 CTGTAGGGAGACCCAGGAGCAGG + Intergenic
1056591349 9:87968308-87968330 ATGAGGGGAGACCCAGATTCTGG + Intronic
1059947778 9:119429481-119429503 CTGAATGGAGTCCCGGGATCAGG - Intergenic
1188015801 X:25106721-25106743 CTGAAGGGAGTCTGGGAGTCAGG + Intergenic
1195577228 X:106464854-106464876 CTGAAGGTAGACTGGCAATCAGG - Intergenic
1197727798 X:129787964-129787986 CTGAAGGGAGAGCTGGAAAAAGG - Exonic
1197941300 X:131793063-131793085 CTGAAGAGAGAACTGGAATTTGG - Intergenic
1199600027 X:149536400-149536422 CTGAAGGGAAACCATGAATCAGG + Intergenic
1199650555 X:149943540-149943562 CTGAAGGGAAACCATGAATCAGG - Intergenic
1200091882 X:153639853-153639875 CTGGAGAGTGGCCCGGAATCGGG + Intergenic