ID: 1104894471

View in Genome Browser
Species Human (GRCh38)
Location 12:132155043-132155065
Sequence CCTGAAGGGAGACCCGGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894471_1104894479 28 Left 1104894471 12:132155043-132155065 CCGATTCCGGGTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1104894479 12:132155094-132155116 TCACAGCTACATCCGTAATGAGG 0: 1
1: 0
2: 0
3: 7
4: 44
1104894471_1104894480 29 Left 1104894471 12:132155043-132155065 CCGATTCCGGGTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1104894480 12:132155095-132155117 CACAGCTACATCCGTAATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 51
1104894471_1104894477 -4 Left 1104894471 12:132155043-132155065 CCGATTCCGGGTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894471 Original CRISPR CCTGAAGGGAGACCCGGAAT CGG (reversed) Intergenic
902337073 1:15759729-15759751 CCTGCGGGGTGACCCCGAATAGG - Intronic
902808695 1:18876189-18876211 CCTAAAGGGAGACCCTAAAAGGG - Intronic
903218917 1:21858078-21858100 TCTGAAGGGAGGCCAGGAAGTGG - Intronic
909438661 1:75673225-75673247 CCTGAAGGGAGAGACTGAAGAGG + Intergenic
911154745 1:94626477-94626499 CCTGAAGGGGGACTCAGAACAGG + Intergenic
911400782 1:97372315-97372337 CCTTAAAGGATACCTGGAATGGG - Intronic
915298960 1:154941319-154941341 CCTTAAGGGAGACCTGGGAGAGG + Intergenic
915318807 1:155044772-155044794 CCTGCAGGAAGACCTGGAACTGG + Intronic
915835643 1:159172907-159172929 CCTGTAGGGAAACCCGGAAGGGG + Intronic
920067131 1:203276922-203276944 CTTGAAGGGTGACCCTGAATTGG - Intergenic
922507085 1:226132891-226132913 ACTGGAAGGAGACCCGGGATTGG - Intergenic
1064423724 10:15212275-15212297 CCTGAAGGGAGACGCTGAGATGG + Exonic
1068257569 10:54533024-54533046 CCTGATGGGAGGCCCTGAACTGG + Intronic
1068529141 10:58164972-58164994 CTTGAAGGGTGAACAGGAATTGG + Intergenic
1074199962 10:111225730-111225752 CCTGAAGGAAGATCTGGAAGAGG + Intergenic
1074774369 10:116756139-116756161 CCTTAAGGGAAACCTGGAAATGG - Intergenic
1075995599 10:126873878-126873900 CCAGGAGGGAGCCCCGGAAAGGG - Intergenic
1076319335 10:129566525-129566547 CCTCCAGAGAGACACGGAATGGG - Intronic
1077186414 11:1237309-1237331 GCTGACGGGAGATCCGGACTTGG - Intronic
1077571283 11:3340426-3340448 CCTGCAGGCAGAGCTGGAATCGG - Intronic
1077679655 11:4227019-4227041 CCTGAAGGGAGAACTGGTAGGGG + Intergenic
1077681831 11:4248888-4248910 CCTGAAGGGAGAACTGGTAGGGG - Intergenic
1077689072 11:4323594-4323616 CCTGAAGGGAGAACTGGTAGGGG + Intergenic
1078844317 11:15107742-15107764 CCTGAAGGGAGCACAGGAAATGG + Intergenic
1081767364 11:45621036-45621058 GCAGAAAGGAGACCTGGAATGGG + Intergenic
1083540227 11:63507106-63507128 CCTGGAGGGAGCCTGGGAATGGG + Intronic
1084799512 11:71533211-71533233 AGTGAAGGGAGACCCTGTATGGG + Intronic
1085456337 11:76667547-76667569 CCTGAGGGGAGCCAGGGAATAGG - Intronic
1096218062 12:49809308-49809330 CCTGAACAGAGACCAGGCATGGG + Intronic
1097174007 12:57132424-57132446 ACTCAAGGGAGACCCAGAATAGG - Intronic
1099167236 12:79321595-79321617 CCTGAAGGTAGAAAAGGAATGGG + Intronic
1102039926 12:109794219-109794241 CCTGTAGGGGGACCCGGAGAAGG - Intronic
1102570163 12:113822646-113822668 CCTGGAGGGAGAGCAGGAACAGG + Intronic
1102633361 12:114301206-114301228 CTTGAAAGGAGATCTGGAATGGG + Intergenic
1103314079 12:120038007-120038029 CCTGAAGGGTGACCTGGAAGTGG + Intronic
1104894471 12:132155043-132155065 CCTGAAGGGAGACCCGGAATCGG - Intergenic
1115115684 14:29878746-29878768 GCTGAAGGGAGGACAGGAATGGG + Intronic
1119443477 14:74645489-74645511 CCTGAAGGCAGAGCCGGGAGTGG + Intergenic
1124193880 15:27603533-27603555 TCTCAAGGGAGACCTGTAATTGG - Intergenic
1126739521 15:51763596-51763618 CCTGAAGAGAGGCCCAGATTAGG - Intronic
1127836957 15:62797740-62797762 CCTGAAGGGAGAGCTGGTGTGGG + Intronic
1129323819 15:74789198-74789220 GCTGACGGGAGCCCCGGGATGGG + Intronic
1130272833 15:82461282-82461304 CCTGAGGAGAGACGGGGAATGGG - Intergenic
1130465183 15:84188635-84188657 CCTGAGGAGAGACGGGGAATGGG - Intergenic
1130487505 15:84406167-84406189 CCTGAGGAGAGACGGGGAATGGG + Intergenic
1130499082 15:84484901-84484923 CCTGAGGAGAGACGGGGAATGGG + Intergenic
1130587474 15:85193248-85193270 CCTGAGGAGAGACGGGGAATGGG - Intergenic
1131016119 15:89059025-89059047 CATGAAGGAAGACTAGGAATGGG + Intergenic
1131052354 15:89357321-89357343 ACTGAAGTGAGACCTGGACTGGG - Intergenic
1135665779 16:24334588-24334610 CCTGAAGGGAGATCCTAAATGGG - Intronic
1135890577 16:26353418-26353440 CCTGCAGGGAGATCCAGAGTGGG + Intergenic
1136280159 16:29203684-29203706 CCAGTTGGCAGACCCGGAATCGG - Intergenic
1141938943 16:87261515-87261537 CCAGAAGGCAGACCTGGAACTGG - Intronic
1142400942 16:89858527-89858549 CCTGAAAAGAGACCAGGAATGGG + Intronic
1142946386 17:3432905-3432927 CATGAAGGGAGCCCTGGAAAGGG - Exonic
1145319037 17:21752537-21752559 CCTGAAGGGATGCCAGGAAAAGG - Intergenic
1146173819 17:30652080-30652102 CGTGAAGGGAGACCTGGAGGAGG - Intergenic
1146748319 17:35352206-35352228 CCTGAAAGGAGAGCCAGAAATGG + Exonic
1146756868 17:35440429-35440451 CCTGAAAGGAGAGCCAGAAATGG + Exonic
1146931677 17:36782440-36782462 CCTGATGTGACACCTGGAATTGG - Intergenic
1146941106 17:36845144-36845166 CCTGAAAGGAGACCCAGCTTAGG + Intergenic
1148289815 17:46435012-46435034 CCTGAAGAGTGAACAGGAATTGG - Intergenic
1148311983 17:46652584-46652606 CCTGAAGAGTGAACAGGAATTGG - Intronic
1150593894 17:66586595-66586617 CCTGAAGTCAGACCCTTAATGGG + Intronic
1151745615 17:76010219-76010241 CCTGCAGGCAGACCTGGAAGTGG - Exonic
1152180092 17:78814187-78814209 CTTGCAGGGAGACACGGAAGAGG - Intronic
1154005262 18:10521954-10521976 CCTGAAGGGAGAGCAGGTATGGG + Intergenic
1160613986 18:80109773-80109795 CCTGAGGGGAGAGTAGGAATAGG + Intronic
1160965645 19:1745968-1745990 CCAGGAGGGAGACTAGGAATGGG + Intergenic
1162090566 19:8276991-8277013 CCTGCAGGGAGACCAGGGAGGGG - Intronic
1162092799 19:8291819-8291841 CCTGCAGGGAGACCAGGGAGGGG - Intronic
1162164511 19:8743267-8743289 CCCGCAGGGACACCCAGAATTGG + Intergenic
1162165583 19:8750735-8750757 CCCGCAGGGACACCCAGAATTGG + Intergenic
1162166648 19:8758191-8758213 CCCGCAGGGACACCCAGAATTGG + Intergenic
1162167714 19:8765647-8765669 CCCGCAGGGACACCCAGAATTGG + Intergenic
1162168653 19:8771945-8771967 CCCGCAGGGACACCCAGAATTGG + Intergenic
1162170399 19:8784709-8784731 CCCGCAGGGACACCCAGAATTGG + Intergenic
1162524678 19:11200561-11200583 CCTGCAGAAAGACCCGCAATAGG + Intronic
1164686715 19:30171773-30171795 TCTGGAGGGAGACCTGGATTCGG - Intergenic
930817792 2:55617228-55617250 CCTGAACGAAGACCGGCAATGGG - Exonic
936078582 2:109417374-109417396 CATGAAGGGAGACAGGGAAGAGG - Intronic
937688814 2:124729999-124730021 CCTGATGAGAGACAAGGAATAGG + Intronic
937932767 2:127219384-127219406 CGCGAAGGGAAACCAGGAATGGG - Intronic
946312832 2:218892444-218892466 CCTGAAGGGGGATCCCAAATAGG - Intronic
1174419603 20:50391036-50391058 CCTGAAGGCAGAGCTGGAACTGG + Intergenic
1176904906 21:14488395-14488417 CCTGAAGAGAGCCCCACAATTGG - Intronic
1181419898 22:22790455-22790477 CCTGCAGGGAAACCCGGGACAGG + Intronic
1182586253 22:31345867-31345889 CCGGAAGGTAGACCGGGAAGGGG - Exonic
1182662163 22:31932957-31932979 ACTGGAGGGAGACCAGGAAGGGG + Intergenic
1183075853 22:35426311-35426333 CCTGAAGGGAGGCCAGGAGAGGG + Intergenic
1183466548 22:37983141-37983163 CCCGTAGGGAGACCCGGCCTAGG + Intronic
1185168414 22:49276616-49276638 CCTGAAGGAAGACCCTGGATGGG - Intergenic
950856534 3:16110895-16110917 CCTGAAAGGTGACCATGAATTGG + Intergenic
952523355 3:34184498-34184520 CCTGCAGGGAGGCACGGAGTGGG + Intergenic
953770572 3:45776127-45776149 CCTGAAGGCAGACTGGGAGTTGG + Intronic
954088726 3:48268007-48268029 CCTGCATGGAAACCTGGAATAGG - Exonic
956510864 3:69991858-69991880 ACTGAAGGGAAAGCTGGAATAGG - Intergenic
957457402 3:80469768-80469790 ACTGAAGGGAGAGGAGGAATAGG - Intergenic
958892158 3:99794826-99794848 CCTCCTGGGATACCCGGAATTGG + Exonic
958952340 3:100429905-100429927 CCGGAGGGGAGAGCTGGAATAGG + Intronic
959252563 3:103966390-103966412 GCTGAAAGGAGACCAGGAGTGGG - Intergenic
961365419 3:126396340-126396362 CCAGGAGAGAGGCCCGGAATGGG - Intronic
962274740 3:134003505-134003527 TCTGCAAGGAGACCTGGAATGGG - Intronic
962520449 3:136193895-136193917 CCTGAAGCAAGACACTGAATGGG - Intronic
964075161 3:152684333-152684355 AGTGGAGGGAGACCCAGAATGGG + Intergenic
966876468 3:184324895-184324917 CCTGAAGGAAGAGCTGGAAGAGG + Exonic
979640669 4:123010028-123010050 CCAGAAGGGAGAACAGTAATTGG + Intronic
980856794 4:138450468-138450490 CTTTAAGGTAGCCCCGGAATTGG + Intergenic
983875160 4:172866763-172866785 CCTGAAGGGTGAGAGGGAATTGG - Intronic
985027183 4:185749392-185749414 CCTGAAGGGTGACTCTCAATGGG - Intronic
995662641 5:114501876-114501898 CCTGAAGGCCTACCCAGAATAGG - Intergenic
996308340 5:122076846-122076868 CCTGAAGGTAGACCGGGGAGCGG + Intronic
1000282723 5:159795971-159795993 CATGAAGGGAAAACAGGAATAGG + Intergenic
1003256111 6:4476376-4476398 GCTGAAGGGGGATGCGGAATTGG - Intergenic
1010942161 6:81931639-81931661 CCTAAAGGGAGACCCTCAATGGG + Intergenic
1017530365 6:155284419-155284441 CCTGAAGGCAGACTCTGTATCGG + Intronic
1017711224 6:157170078-157170100 TCTGAAGGGAGCCCCAGAATCGG - Intronic
1021828137 7:24574029-24574051 CCTGAATGGAGAGCCGGCCTGGG + Intronic
1031263146 7:119548684-119548706 TCTGAAGGGAGGCCAGGAAAGGG + Intergenic
1034262044 7:149763330-149763352 CCAGAAGGGAGACTCGGTGTTGG - Intergenic
1034847425 7:154459432-154459454 CCTGAATTGAGAGCCTGAATCGG - Intronic
1034983744 7:155494836-155494858 CCTCCAGGGAGACCTGGCATCGG - Intronic
1035366695 7:158352988-158353010 GCTGTTAGGAGACCCGGAATAGG - Intronic
1036779746 8:11637841-11637863 ACTGGAGGGAGACCCTGAAGAGG + Intergenic
1038184158 8:25257670-25257692 CCTGGAGGGAGATCAGGGATTGG + Intronic
1039911944 8:41833163-41833185 GCTGGAGGGAGGCCCGGGATGGG - Intronic
1042710824 8:71715340-71715362 GCAGAAGGGAGGCCAGGAATTGG + Intergenic
1054803082 9:69371705-69371727 CCTGAAGTGAAACCTGAAATGGG + Intronic
1056074416 9:83023986-83024008 CCTGGAGGGAGCCCCGGACTAGG - Intronic
1061400960 9:130368160-130368182 CCTGAAGGATGAGCAGGAATTGG + Intronic
1062012663 9:134275397-134275419 CCTGAAGGCAGACCCTGACCAGG - Intergenic
1189017919 X:37303454-37303476 CCTGTCTGGAGACGCGGAATGGG - Intergenic
1191937192 X:66438389-66438411 GCTGGAGGGAGTCCCGGAATGGG + Intergenic
1192713335 X:73615312-73615334 CCTGACTGGAGACCAAGAATTGG - Intronic
1199930244 X:152510983-152511005 CCTGAAGGGAGAACTGTGATTGG - Intergenic
1199941875 X:152635881-152635903 CCTCTAGGGAGACCCGAAGTAGG + Intergenic
1200091881 X:153639852-153639874 CCTGGAGAGTGGCCCGGAATCGG + Intergenic
1202370054 Y:24190068-24190090 CCTGAGGAGAGACAGGGAATGGG + Intergenic
1202500730 Y:25480049-25480071 CCTGAGGAGAGACAGGGAATGGG - Intergenic