ID: 1104894473

View in Genome Browser
Species Human (GRCh38)
Location 12:132155049-132155071
Sequence TCATTTCCTGAAGGGAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894473_1104894480 23 Left 1104894473 12:132155049-132155071 CCGGGTCTCCCTTCAGGAAATGA 0: 1
1: 0
2: 2
3: 16
4: 201
Right 1104894480 12:132155095-132155117 CACAGCTACATCCGTAATGAGGG 0: 1
1: 0
2: 0
3: 6
4: 51
1104894473_1104894477 -10 Left 1104894473 12:132155049-132155071 CCGGGTCTCCCTTCAGGAAATGA 0: 1
1: 0
2: 2
3: 16
4: 201
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894473_1104894479 22 Left 1104894473 12:132155049-132155071 CCGGGTCTCCCTTCAGGAAATGA 0: 1
1: 0
2: 2
3: 16
4: 201
Right 1104894479 12:132155094-132155116 TCACAGCTACATCCGTAATGAGG 0: 1
1: 0
2: 0
3: 7
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894473 Original CRISPR TCATTTCCTGAAGGGAGACC CGG (reversed) Intergenic
901615719 1:10538026-10538048 TAAATTCCTGATGGGAGTCCAGG - Intronic
901883209 1:12205934-12205956 TCATCTTTTGAAGGGAGACAAGG + Intronic
902509713 1:16959663-16959685 TCATTTCCTGATGGGATGCATGG - Intronic
902962382 1:19974154-19974176 TCATTTGCTGAAGGCGGCCCTGG - Intergenic
904113895 1:28147863-28147885 TCATTTCCTGCTGAGGGACCAGG - Exonic
904199904 1:28812714-28812736 GCATTTCCTGCAGGGGCACCTGG + Intronic
906153466 1:43600961-43600983 TCCTTGCCTGCGGGGAGACCTGG - Intronic
906607418 1:47181762-47181784 TCACTTGCTGCAGGGAGACAGGG + Intergenic
907290676 1:53410515-53410537 TCCTTTCCTGAAGGCAGCCAGGG - Intergenic
907630560 1:56077104-56077126 TCCATTCCTGAAAGGAGACAGGG + Intergenic
909211380 1:72829192-72829214 TCATTTTCTGAAGAGGGAGCTGG - Intergenic
910198427 1:84671170-84671192 TAATTACCTGAAGACAGACCTGG + Exonic
911292565 1:96075442-96075464 TCATTTTCTGTAGGGAGAGGTGG - Intergenic
911767628 1:101697834-101697856 CCATTTCCTGAAGGCAGATCTGG + Intergenic
912257533 1:108076199-108076221 TCATTCCCTGAAGGGAGAAAAGG - Intergenic
913572232 1:120132033-120132055 TCAGTTGCTGGAGGGAGGCCAGG + Intergenic
914293152 1:146293677-146293699 TCAGTTGCTGGAGGGAGGCCAGG + Intergenic
914554196 1:148744460-148744482 TCAGTTGCTGGAGGGAGGCCAGG + Intergenic
915039005 1:152952101-152952123 TCATGTCCTCAAGGCAGTCCTGG + Intergenic
915657674 1:157375158-157375180 TCATGACCTGGAGGGAGATCTGG - Intergenic
916483024 1:165232545-165232567 TGCTTTCCTGAAAGCAGACCAGG - Intronic
919576211 1:199312815-199312837 GCATTTCCTGAAGTGCCACCAGG + Intergenic
920390764 1:205599236-205599258 TCCTTACCTGATGGGAGTCCAGG - Exonic
1063186682 10:3658271-3658293 TCATTTTCTGAAGGGAGGAATGG - Intergenic
1064437529 10:15324254-15324276 TCTTTTCCTAAAGGAAGACGGGG + Intronic
1064586964 10:16849006-16849028 TCCTTTCCTAAAATGAGACCTGG - Intronic
1066101030 10:32118770-32118792 TCATATTCTGAAGAGAAACCTGG + Intergenic
1067542286 10:47164760-47164782 TCATGTCCTGAGAGGATACCTGG - Intergenic
1067828863 10:49598461-49598483 TCAGGTCCAGATGGGAGACCAGG - Intergenic
1070318432 10:75336053-75336075 TCAGTTCCTGAGGGCAGGCCAGG - Intergenic
1072417250 10:95259482-95259504 TCATTTTCAGAAGGGAAGCCTGG + Intronic
1072816547 10:98515049-98515071 TGCTTGCCTCAAGGGAGACCAGG - Intronic
1073383290 10:103098966-103098988 TCTTTTCCTTAAGGGAGCCCTGG + Exonic
1074313415 10:112341684-112341706 TCCCTTCCTGAAGACAGACCTGG - Intergenic
1076106959 10:127831184-127831206 GCATGTCCTGAAAGGAAACCTGG + Intergenic
1076476443 10:130756987-130757009 TCCTTTCCTGCAGGAAGTCCAGG - Intergenic
1076682735 10:132182399-132182421 TCCATTCCTGCTGGGAGACCCGG + Exonic
1080450346 11:32374196-32374218 TCATTTACTGAAAGGTTACCAGG + Intergenic
1080950170 11:37022552-37022574 TCCTTTCTTGAAAGGTGACCTGG + Intergenic
1081435830 11:43026603-43026625 TCAGTTCCTGTATGGAAACCTGG - Intergenic
1083108084 11:60377754-60377776 CCATTTCCTGAAGGGTGGCAAGG - Intronic
1083306571 11:61764867-61764889 TCATTCCCTGCTGGGAGGCCGGG + Intronic
1084804941 11:71572340-71572362 TCATTTCCTGTGGGCAGCCCCGG + Intergenic
1090435543 11:126683912-126683934 ACAGTCCCTGAAGGGGGACCTGG - Intronic
1091238592 11:134037496-134037518 TCTTTTCCTGAGGGGAAACGGGG - Intergenic
1094059667 12:26300418-26300440 TCATTCCTTGAAGGGGGATCTGG - Intergenic
1099745222 12:86693178-86693200 GCAGTTTCTGAAGGCAGACCTGG + Intronic
1100395026 12:94178378-94178400 TGAATTCCTGAAGAGATACCAGG + Intronic
1102107552 12:110338443-110338465 GCATTGGCTGAAGGGAGACAAGG - Intronic
1103056290 12:117823692-117823714 TCATTTCCAAAAGGGAGAAGTGG + Intronic
1104894473 12:132155049-132155071 TCATTTCCTGAAGGGAGACCCGG - Intergenic
1105810695 13:23992632-23992654 TCATTTCTTAAAGAGAGTCCCGG - Intronic
1110280834 13:73692737-73692759 TCAGTTCCTGAGGCTAGACCAGG + Exonic
1113458031 13:110462801-110462823 TCATTTCCTCAGGGGAGGCTGGG + Intronic
1117344270 14:54817551-54817573 TCATTTTGTGATGGGAGACATGG - Intergenic
1119823975 14:77641916-77641938 TCATTCCGAGAAGGGAGAGCGGG + Intergenic
1122267128 14:100551932-100551954 TCATTTGCTGAGGGTAGACCTGG - Intronic
1123939175 15:25208505-25208527 TCCTGTCCTGAAGGCTGACCTGG - Intergenic
1127341420 15:58048729-58048751 TCATTTGATTAAGGGAGACTGGG - Intronic
1127651875 15:61016876-61016898 TGATTTCATTAAGTGAGACCTGG + Intronic
1128593582 15:68924723-68924745 TCAATTCATGAAATGAGACCTGG - Intronic
1129033332 15:72634129-72634151 TAATATCCTAAAGGGAGGCCGGG + Intergenic
1129216553 15:74103101-74103123 TAATATCCTAAAGGGAGGCCGGG - Intronic
1129471280 15:75755749-75755771 TAATATCCTGTAGGGAGGCCAGG + Intergenic
1132201445 15:99957044-99957066 ACATTGCCTGAAGGGTGAGCTGG + Intergenic
1133880051 16:9773094-9773116 TAATCTCCTGGAGGGAGATCAGG + Intronic
1141671007 16:85491683-85491705 CCCCTTCCTGAAAGGAGACCAGG - Intergenic
1144657717 17:17048186-17048208 TCATTTCCAGATGGGAAAACAGG - Intronic
1146948164 17:36888174-36888196 TTATTTCCTGCAGGGAGACCAGG + Intergenic
1148474513 17:47918561-47918583 TTATTTCCTTAGGGAAGACCTGG - Intronic
1149797129 17:59530935-59530957 TCTTTCCCTGAAGGAAGAGCAGG + Intergenic
1150344080 17:64390884-64390906 TCATTTCCTGAGGAGATATCAGG - Intronic
1151144617 17:72029569-72029591 TCATTTCCTAAAATGAGATCTGG + Intergenic
1152011234 17:77719587-77719609 TCATATCATCAAGGGAGTCCTGG - Intergenic
1152289682 17:79432675-79432697 TCATTTACTGATGAGAAACCAGG + Intronic
1152655075 17:81515422-81515444 ACATTTCAGGAAGGGAGACTTGG + Intronic
1153416933 18:4856200-4856222 TCTTTTCCTAAAAGGATACCAGG + Intergenic
1156597758 18:38566884-38566906 TGATTTGCTGAAGGGAGGACAGG - Intergenic
1158008116 18:52696558-52696580 TCATTTCCTAATGGCATACCAGG - Intronic
1158407177 18:57170213-57170235 TGATTTCCTCAAGGGAGGCAGGG - Intergenic
1158933243 18:62341506-62341528 TCATTCCCTGAGGGGAGAGAGGG - Intronic
1160362394 18:78294891-78294913 ACTCTTCCTGAATGGAGACCTGG - Intergenic
1162248041 19:9419264-9419286 TCTTTTCTTGAAGGCAGACTGGG + Exonic
1163456074 19:17406379-17406401 TGATTTCCTGTAGGAAGCCCTGG - Intronic
1165120268 19:33554240-33554262 TCATTCCCACAAGGTAGACCTGG - Intergenic
1166128910 19:40733652-40733674 TCTTGTGCTGCAGGGAGACCAGG - Intronic
1166824054 19:45598464-45598486 TAATTTCCTCAAGGGGGAACCGG + Intronic
1168258107 19:55178225-55178247 TCACTTCCTGAAGGTGGACCTGG + Exonic
926350415 2:11989212-11989234 TCATCTCCTGGAGGAAGACAAGG - Intergenic
927748009 2:25640512-25640534 TTATTTCCTCAGGGGATACCTGG + Intronic
928064280 2:28147766-28147788 TAATTTCCTAAAGGGAGGCCGGG - Intronic
929120981 2:38484008-38484030 TCCTTTCCTAAAGGGAGATCTGG - Intergenic
931805274 2:65797941-65797963 TCATTTTGTGTAGGGAGGCCAGG + Intergenic
932475595 2:72003873-72003895 TCCTTTCTTGAAGGAAGTCCTGG - Intergenic
933800962 2:85960065-85960087 GCCATTCCTGAAGGGAGACAAGG + Intergenic
935460637 2:103328983-103329005 TGATGTCCTGGATGGAGACCTGG - Intergenic
936021925 2:109001615-109001637 TCCTTTCCAAAAGGGAGGCCAGG - Intergenic
937693159 2:124779074-124779096 TCCTTCTTTGAAGGGAGACCTGG - Intronic
939125733 2:138175370-138175392 TCATTAGCAGAATGGAGACCAGG + Intergenic
939681967 2:145147461-145147483 TGGTTACCTGAAGGGAGACATGG - Intergenic
941231732 2:162918234-162918256 TTTATTCCTGAAGGGAGACATGG - Intergenic
943904514 2:193480715-193480737 ACAGTTCCTCAAGGGAGAGCAGG + Intergenic
948373603 2:237505777-237505799 TCCTGTCCTCAAGGGAGGCCCGG - Intronic
1169157479 20:3344681-3344703 TGATTTCCTTAAGGCAGATCTGG + Intronic
1169167007 20:3432718-3432740 TTCTTCCCTGAAGGGAGATCTGG - Intergenic
1169537042 20:6556514-6556536 TCAATTCCTGAATGGAGATTTGG - Intergenic
1170691881 20:18623724-18623746 GTATGTCCTGAAAGGAGACCCGG - Intronic
1170696607 20:18664900-18664922 CCTCTTCCTTAAGGGAGACCTGG + Intronic
1172623749 20:36335869-36335891 TCATTACAGGCAGGGAGACCAGG - Intronic
1173354842 20:42277541-42277563 TCATTTTCTGAAAGGAGAAATGG + Intronic
1174136007 20:48380251-48380273 TTATTTTGTGAAGTGAGACCAGG - Intergenic
1174906654 20:54559124-54559146 TTATTTCCTGAAGGAAAACATGG - Intronic
1175411962 20:58776350-58776372 CCTTTTCCTCAAGGGTGACCTGG + Intergenic
1176184871 20:63772924-63772946 TCCTTTCCGGAAGCGAGCCCCGG - Intronic
1177490053 21:21811857-21811879 TTATTTTCTGCAGGGTGACCAGG + Intergenic
1181981285 22:26768621-26768643 TCATTTCCTTCAGGCCGACCAGG + Intergenic
1183219556 22:36503941-36503963 TCATGTCCTGGAGGGAAATCAGG + Intronic
949854915 3:8452630-8452652 TCCTTTCCTGAAGGAGGATCTGG - Intergenic
951117738 3:18885516-18885538 TTTTATCCTGAAGGGAGACTTGG + Intergenic
951552196 3:23885368-23885390 TCATTTCCTGAGGTTAGAACCGG - Intronic
951566552 3:24017528-24017550 TCCTTTCTTGAAGGGGGATCTGG + Intergenic
951825658 3:26865443-26865465 TCCTTCACTGAAGGGAGACCTGG - Intergenic
952899103 3:38097872-38097894 GCCTTTCCTGGAGGGAGACTGGG - Exonic
952969925 3:38644396-38644418 TCATTTCCCCAAGGGGTACCTGG - Intronic
953077548 3:39583923-39583945 ACATTTCCTTAAGGGAGAAAAGG + Intergenic
953787849 3:45924068-45924090 TCATATCCTGAAGGCAGAAAAGG - Intronic
954088728 3:48268013-48268035 TGATTTCCTGCATGGAAACCTGG - Exonic
954831280 3:53423236-53423258 TCCATTCCTGAAGGGAGGTCAGG + Intergenic
956115816 3:65917532-65917554 TCATTTACTGAAGGATGACTTGG - Intronic
956362869 3:68467681-68467703 ATTTTTCCTGAAGGCAGACCAGG + Intronic
957536948 3:81518348-81518370 TTTTTTCTTGAAGGGGGACCAGG - Intronic
958440444 3:94149977-94149999 TTATTTCCTTTAGGGAAACCAGG + Intergenic
960484697 3:118237777-118237799 TCTTTCCCTGAAAGGAGACACGG - Intergenic
961716543 3:128861481-128861503 TCCTTACCAGAAGGGGGACCAGG + Intergenic
964840336 3:160986665-160986687 TCATTTCCTGCAGAGGGGCCTGG + Intronic
965180607 3:165398193-165398215 TCATTTCCTTAGTGGAGTCCAGG + Intergenic
965614374 3:170577971-170577993 TCATTTCCTGGAGGTAGGCTTGG - Intronic
966294604 3:178404736-178404758 TCATTTCCTTAAGCAATACCCGG + Intergenic
966529134 3:180954769-180954791 TCATTTCCTAAAGGCAGAACAGG - Intronic
968040421 3:195584396-195584418 TCATTTCCTGAAGTGGAACATGG + Intergenic
969202791 4:5618970-5618992 TCTGTTTCTGAAGTGAGACCAGG - Intronic
969277022 4:6142755-6142777 TCAGTTCATGAAGGCAGAGCTGG + Intronic
969607436 4:8209652-8209674 TCTTTTCTTGCAGAGAGACCTGG + Intronic
971894843 4:32579269-32579291 TCCTTTCCTGAAGGGGGATTTGG + Intergenic
973773715 4:54227774-54227796 TGATTTCCTGAAGGGACATGTGG + Intronic
974241450 4:59253820-59253842 TCAATTCCTGAAGAGATATCAGG - Intergenic
974645225 4:64681129-64681151 TCATTTTCTGAAGTGAGCCATGG - Intergenic
975245080 4:72111228-72111250 TAATTTCATGAAGTGGGACCTGG - Intronic
975497326 4:75049012-75049034 CCATTTCCTTTAGGCAGACCTGG - Exonic
975962941 4:79934911-79934933 TCAGTTCCTGAAAGCAGACAAGG - Intronic
976026900 4:80698895-80698917 TCATGTGTTGAAGGGGGACCTGG - Intronic
976098024 4:81529312-81529334 CCATTCCCTGAAGAAAGACCAGG + Intronic
977058273 4:92220791-92220813 TCATTCCCTCAAAGCAGACCTGG - Intergenic
977359287 4:95982354-95982376 TCAATTTCTGAAGGGGAACCTGG + Intergenic
983252980 4:165365702-165365724 TTAATTCCTGAAGGAAGACCTGG + Intronic
983992371 4:174136258-174136280 TCTTTTCCTGAAGGATGACTTGG - Intergenic
984014172 4:174406207-174406229 TCATTTCCTTAATATAGACCTGG + Intergenic
984770944 4:183435952-183435974 TCATTTCCTCAGGGGATTCCGGG + Intergenic
986118648 5:4807100-4807122 TGATTTCAAGAAGTGAGACCAGG + Intergenic
988272672 5:29036718-29036740 CCAGTTCCAGAAGGGAAACCTGG + Intergenic
988318473 5:29661661-29661683 TCATTTACTGATGGAAGAACGGG - Intergenic
989111996 5:37915346-37915368 TCAGGTTCTGAAGTGAGACCTGG - Intergenic
991574881 5:68092487-68092509 TTATTCATTGAAGGGAGACCTGG + Intergenic
994258909 5:97633982-97634004 TGGTTACCTGAAGGGAGACATGG - Intergenic
995182900 5:109245447-109245469 TCCTTTCCTGATGGGAGCTCTGG - Intergenic
996088543 5:119328025-119328047 TTCTTCCCTGCAGGGAGACCTGG - Intronic
996094493 5:119383908-119383930 TTCTTCCCTGCAGGGAGACCTGG + Intronic
996174415 5:120336976-120336998 TGGTTTCCAGAAGGGAGTCCTGG - Intergenic
996884692 5:128341439-128341461 TTCTTTCCTGAAGAGGGACCTGG - Intronic
997695703 5:135859005-135859027 TCATTTTCTGGAGGGATTCCTGG - Intronic
999926654 5:156386014-156386036 TCATTACCTGATAGGAGATCTGG - Intronic
1000415233 5:160977289-160977311 TCCTTTCATGAAGGGAAATCTGG + Intergenic
1000761866 5:165236041-165236063 TCATTTCCTGAGTGTAAACCAGG + Intergenic
1001201107 5:169717738-169717760 TCATTTCTTGAGTGGACACCAGG + Intronic
1001759944 5:174198970-174198992 CCATTTCCAGAAGGGAAACCTGG - Intronic
1002850253 6:988248-988270 TCCTTTCCTGAAGGGAGGCCTGG + Intergenic
1002889700 6:1321598-1321620 TCAGTTCTAGAAAGGAGACCAGG + Intergenic
1003893952 6:10589492-10589514 TCCTTTCCAGAAAGGACACCTGG - Intronic
1004592047 6:17061233-17061255 TGATTTCCTAAAGGGAAACTGGG - Intergenic
1004699982 6:18069701-18069723 TGTTCTCCTGAAGCGAGACCTGG - Intergenic
1005795454 6:29356203-29356225 CCAATTCCTGAAAGGAAACCAGG - Exonic
1007429312 6:41767549-41767571 TCCTTTCCTGAGGGCAGCCCAGG + Intergenic
1012239074 6:96851553-96851575 TCATTTCCCAAAGTGAGAACAGG - Intergenic
1014573530 6:123041331-123041353 GCATTTACTGTAGGGAGAACAGG - Intronic
1020737023 7:11963653-11963675 TGATTTCCTTAAGGGATCCCAGG + Intergenic
1022202976 7:28136014-28136036 TTATTTCCTGAAGTGAAACATGG - Intronic
1024655989 7:51451761-51451783 ACAGATCCTGGAGGGAGACCAGG + Intergenic
1027815506 7:82964786-82964808 TCATTTAATGAAAGGAGACCAGG + Intronic
1030538853 7:110803751-110803773 TCATTCCTTGAAGGAACACCTGG + Intronic
1031402782 7:121345552-121345574 TCCTTTCCCTAAGGGAGAACAGG + Intergenic
1034161945 7:149000522-149000544 CCATCTCCTGGAGGGAGGCCTGG + Intergenic
1035108659 7:156462526-156462548 CTTTTTCCTGAAGGGAGATCCGG + Intergenic
1035592159 8:824430-824452 TCATTTCCTGCAGGGAACCCTGG - Intergenic
1039702821 8:39979084-39979106 CCAGTTCCTGAAGGGTCACCGGG + Exonic
1042542388 8:69920261-69920283 TCATTTGTTTAAGAGAGACCTGG - Intergenic
1042683697 8:71414308-71414330 TTCATTCCTGAAGGGAGATCTGG + Intronic
1043109095 8:76155256-76155278 TCATTTCCTTATGGGATATCAGG - Intergenic
1044789773 8:95835454-95835476 TGATTTCCTCAAGGGAGTCCTGG - Intergenic
1045547578 8:103141569-103141591 TCATTTCCTAGAGGGAGAAAAGG - Intronic
1046743669 8:117854336-117854358 TCATATTGTGAAGGTAGACCAGG + Intronic
1047082341 8:121477003-121477025 TCATTTCCTGAACAGATGCCAGG - Intergenic
1048733147 8:137466869-137466891 TCATTCTCTCAAGGGAGGCCAGG - Intergenic
1048857828 8:138699094-138699116 GCCTTTCCTGAAGGGAGAGAAGG - Intronic
1049672383 8:143875773-143875795 TCACTTCCTGAAGGCACAGCCGG + Intronic
1050935903 9:11394016-11394038 TAATTTCCTGAAGGGTAATCAGG + Intergenic
1052033597 9:23656214-23656236 TCATGTGCTCAAGGGATACCTGG - Intergenic
1054870000 9:70040449-70040471 TCATTTCTTGAAGGGGGATCTGG - Intergenic
1057128926 9:92640078-92640100 TCAGCTCCTGCAGGGAGCCCAGG + Intronic
1057481468 9:95448322-95448344 CCATTTCCTGGAGGGACAGCAGG + Intronic
1058436659 9:104969496-104969518 TCCTTTCCCCCAGGGAGACCAGG + Intergenic
1059072600 9:111154460-111154482 TCCTTTCTTGAAAGGTGACCTGG - Intergenic
1060624138 9:125095033-125095055 TTCTTTCTTGAAGGGAGAGCTGG - Intronic
1187355505 X:18566713-18566735 TTATTGCCTGAATGGAGACATGG + Intronic
1187799275 X:23042320-23042342 TCCTTTAATGAAGGGAGATCTGG + Intergenic
1188042171 X:25381459-25381481 AACTTTCCTGAAGGAAGACCAGG - Intergenic
1189226614 X:39418845-39418867 TCATTTGCTGAAGGGGCACCCGG - Intergenic
1189847087 X:45148028-45148050 TTGTTTCTTGAAGGGAGAGCTGG + Intergenic
1193860157 X:86655114-86655136 TCATTTCAACAAGGGAGATCAGG + Intronic
1197990434 X:132311481-132311503 GCATTTCCTGAAACCAGACCAGG + Intergenic
1198614797 X:138444878-138444900 TCCTTCCCTGAAGGGGGATCTGG + Intergenic