ID: 1104894477

View in Genome Browser
Species Human (GRCh38)
Location 12:132155062-132155084
Sequence CAGGAAATGAACGCGGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894473_1104894477 -10 Left 1104894473 12:132155049-132155071 CCGGGTCTCCCTTCAGGAAATGA 0: 1
1: 0
2: 2
3: 16
4: 201
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894461_1104894477 13 Left 1104894461 12:132155026-132155048 CCCTCTCCTCCCGTCCCCCGATT 0: 1
1: 0
2: 1
3: 33
4: 368
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894471_1104894477 -4 Left 1104894471 12:132155043-132155065 CCGATTCCGGGTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894467_1104894477 3 Left 1104894467 12:132155036-132155058 CCGTCCCCCGATTCCGGGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894469_1104894477 -2 Left 1104894469 12:132155041-132155063 CCCCGATTCCGGGTCTCCCTTCA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894465_1104894477 7 Left 1104894465 12:132155032-132155054 CCTCCCGTCCCCCGATTCCGGGT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894462_1104894477 12 Left 1104894462 12:132155027-132155049 CCTCTCCTCCCGTCCCCCGATTC 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894470_1104894477 -3 Left 1104894470 12:132155042-132155064 CCCGATTCCGGGTCTCCCTTCAG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894468_1104894477 -1 Left 1104894468 12:132155040-132155062 CCCCCGATTCCGGGTCTCCCTTC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894466_1104894477 4 Left 1104894466 12:132155035-132155057 CCCGTCCCCCGATTCCGGGTCTC 0: 1
1: 0
2: 1
3: 9
4: 249
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894477 Original CRISPR CAGGAAATGAACGCGGCTGC CGG Intergenic
903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG + Intergenic
906593079 1:47046528-47046550 CTGGAAATGGACGGGACTGCAGG - Exonic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
913189604 1:116402512-116402534 CAGGAAGTGAATGAGGCTGATGG - Intronic
915281092 1:154822677-154822699 CAGGAGATGAGAGCAGCTGCCGG - Intronic
918667700 1:187172287-187172309 CAGGAAGTGACAGCTGCTGCAGG - Intergenic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1073596892 10:104809597-104809619 CAGGAAATGAGTGTGGTTGCAGG + Intronic
1076637304 10:131890997-131891019 CAGGAAGGGGACGCAGCTGCAGG - Intergenic
1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG + Intronic
1093351259 12:18105544-18105566 CAGGAGCTGAACCAGGCTGCGGG - Intronic
1093958761 12:25250787-25250809 CAGGCACTGAAGGCGGCGGCGGG - Exonic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1104569349 12:129911354-129911376 CTGGAAATAAACGCAGCAGCAGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104932584 12:132347650-132347672 CATGAAATGAACTCAGCAGCGGG - Intergenic
1104939748 12:132389464-132389486 GAGGCAATTAACGTGGCTGCTGG - Intergenic
1110705375 13:78597728-78597750 CAGGAAATCCAGGCGGCGGCGGG - Intergenic
1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG + Intergenic
1111578857 13:90196349-90196371 CAGGAAATGAAAGAGGCATCAGG - Intergenic
1113474623 13:110571730-110571752 CTGGAAATAAATGAGGCTGCGGG + Intergenic
1113692651 13:112322638-112322660 AAGGCATTCAACGCGGCTGCAGG + Intergenic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1135459033 16:22625201-22625223 AAGGAAATGAAAGGGGCTGGGGG - Intergenic
1135918788 16:26629348-26629370 CTTGAAATGAACGCCACTGCAGG - Intergenic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1141860386 16:86712344-86712366 CAGGTAATGCACCCAGCTGCGGG - Intergenic
1141920506 16:87132599-87132621 CAAGAAATGTAGCCGGCTGCTGG - Intronic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG + Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1149877400 17:60249632-60249654 GAGGAAATGAAAGCTGCTCCTGG + Intronic
1151552944 17:74832349-74832371 GAGGATATGAAGGCGGGTGCTGG - Intronic
1152401784 17:80070866-80070888 CAGGGAATGACCGTGGCTGTGGG + Intronic
1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG + Intergenic
1153473570 18:5472378-5472400 CAGGAAATTACTGCTGCTGCTGG + Intronic
1156914927 18:42454458-42454480 CAGGATATGAACAAGGGTGCTGG + Intergenic
926309762 2:11667038-11667060 CAGGACAAGAACATGGCTGCTGG - Intronic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
935870612 2:107444458-107444480 ATGGAAATGAACTGGGCTGCAGG + Intergenic
937475388 2:122210370-122210392 CAGGAGATGGACCCTGCTGCTGG + Intergenic
941765545 2:169292569-169292591 CAGGAAATGAACTCAGGTGCCGG + Intronic
946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG + Intronic
1171085229 20:22232575-22232597 CAGGCAATGAGTGCAGCTGCTGG + Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG + Intergenic
1175334271 20:58184979-58185001 AATGAAATGAAGGTGGCTGCAGG - Intergenic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1179520754 21:41942830-41942852 CTGGAAATGAACCCGCCTGGTGG + Intronic
1180061959 21:45390244-45390266 CAGGTAACGAACTCGGCCGCTGG + Intergenic
949568735 3:5270755-5270777 CAGGAAATGAGGGCAGCCGCTGG - Intergenic
949955713 3:9267027-9267049 TAGGAAATGAACGCAGCATCGGG + Intronic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
953469660 3:43155867-43155889 CAGTAAACGGACGCTGCTGCGGG - Intergenic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
963605287 3:147407759-147407781 CAAAAAATGCACGCGGATGCGGG - Intronic
968410571 4:386527-386549 CAGGGAAGGTGCGCGGCTGCGGG - Intergenic
969712540 4:8852252-8852274 CATCCAGTGAACGCGGCTGCAGG + Intronic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
974615184 4:64271413-64271435 AAAGAAATGAAAGCGGCTGGAGG + Intergenic
977864357 4:102005859-102005881 CAGGAATTAAACTTGGCTGCTGG + Intronic
978691921 4:111523906-111523928 CAGCAAATGGATGCGGCTGGAGG - Intergenic
982584872 4:157222927-157222949 CAGGAAATGATGGCAGCTGCTGG - Intronic
985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG + Intergenic
986152678 5:5141329-5141351 CAGGATATGAACGTTGCTGATGG - Intronic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
999657489 5:153825059-153825081 GAGCAAATGAACGCGCCTGCAGG - Intergenic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1006385966 6:33731135-33731157 CAGGAACTGCACGAGGCTGCTGG - Intronic
1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG + Intergenic
1015284451 6:131469352-131469374 CAGGAAATGATCTCAGCTCCTGG - Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1018944489 6:168337008-168337030 CAGGAAAGGATGGCGGCTACTGG - Intergenic
1036747795 8:11422449-11422471 CAGGAAAGGAATGCGTCTTCAGG + Exonic
1037962024 8:23104982-23105004 CAGGAACTGAACTCAGCTCCAGG - Intronic
1038327036 8:26579170-26579192 CAGACAATGATCGCGGCGGCCGG + Intronic
1041704890 8:60836141-60836163 CAGGCAATGATCCAGGCTGCTGG + Exonic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG + Intergenic
1186917962 X:14244142-14244164 AAGGAAATGGACGCAGCTGTTGG - Intergenic
1187000185 X:15168569-15168591 CAGGAAATGAAAGTGGTTGGGGG - Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1192736171 X:73851367-73851389 CAGGAAAAGATGGCGGCTGAAGG - Intergenic
1199338085 X:146642933-146642955 CAGCACATGAAAGCAGCTGCAGG + Intergenic
1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG + Intergenic