ID: 1104894794

View in Genome Browser
Species Human (GRCh38)
Location 12:132158861-132158883
Sequence GAATGCAGGATGATCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894794_1104894807 29 Left 1104894794 12:132158861-132158883 CCAGCTGAGATCATCCTGCATTC No data
Right 1104894807 12:132158913-132158935 TCCTAGTCAGAGGCGTGAAGAGG No data
1104894794_1104894801 0 Left 1104894794 12:132158861-132158883 CCAGCTGAGATCATCCTGCATTC No data
Right 1104894801 12:132158884-132158906 AGGGTGGGCCATCAGTCCGGTGG No data
1104894794_1104894805 19 Left 1104894794 12:132158861-132158883 CCAGCTGAGATCATCCTGCATTC No data
Right 1104894805 12:132158903-132158925 GTGGCCGGTGTCCTAGTCAGAGG No data
1104894794_1104894802 4 Left 1104894794 12:132158861-132158883 CCAGCTGAGATCATCCTGCATTC No data
Right 1104894802 12:132158888-132158910 TGGGCCATCAGTCCGGTGGCCGG No data
1104894794_1104894800 -3 Left 1104894794 12:132158861-132158883 CCAGCTGAGATCATCCTGCATTC No data
Right 1104894800 12:132158881-132158903 TTCAGGGTGGGCCATCAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894794 Original CRISPR GAATGCAGGATGATCTCAGC TGG (reversed) Intergenic
No off target data available for this crispr