ID: 1104894801

View in Genome Browser
Species Human (GRCh38)
Location 12:132158884-132158906
Sequence AGGGTGGGCCATCAGTCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894794_1104894801 0 Left 1104894794 12:132158861-132158883 CCAGCTGAGATCATCCTGCATTC No data
Right 1104894801 12:132158884-132158906 AGGGTGGGCCATCAGTCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894801 Original CRISPR AGGGTGGGCCATCAGTCCGG TGG Intergenic
No off target data available for this crispr