ID: 1104896034

View in Genome Browser
Species Human (GRCh38)
Location 12:132164059-132164081
Sequence CGCTGGGCTCCCGGCTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104896029_1104896034 15 Left 1104896029 12:132164021-132164043 CCAGCAGTCTCACCGTGTTCGTA No data
Right 1104896034 12:132164059-132164081 CGCTGGGCTCCCGGCTGCTCAGG No data
1104896030_1104896034 3 Left 1104896030 12:132164033-132164055 CCGTGTTCGTACTGTTAAAGAAG No data
Right 1104896034 12:132164059-132164081 CGCTGGGCTCCCGGCTGCTCAGG No data
1104896028_1104896034 16 Left 1104896028 12:132164020-132164042 CCCAGCAGTCTCACCGTGTTCGT No data
Right 1104896034 12:132164059-132164081 CGCTGGGCTCCCGGCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104896034 Original CRISPR CGCTGGGCTCCCGGCTGCTC AGG Intergenic