ID: 1104896960

View in Genome Browser
Species Human (GRCh38)
Location 12:132169228-132169250
Sequence GTGGCAGGGGGGAGACAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104896944_1104896960 14 Left 1104896944 12:132169191-132169213 CCACGTGGCAGGGGGAGAAGCAG No data
Right 1104896960 12:132169228-132169250 GTGGCAGGGGGGAGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104896960 Original CRISPR GTGGCAGGGGGGAGACAGCG GGG Intergenic
No off target data available for this crispr