ID: 1104896986

View in Genome Browser
Species Human (GRCh38)
Location 12:132169296-132169318
Sequence GTGGCAGGGGGGAGACAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104896970_1104896986 14 Left 1104896970 12:132169259-132169281 CCACGTGGCAGGGGGAGAAGCAG No data
Right 1104896986 12:132169296-132169318 GTGGCAGGGGGGAGACAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104896986 Original CRISPR GTGGCAGGGGGGAGACAGCG GGG Intergenic
No off target data available for this crispr