ID: 1104899124

View in Genome Browser
Species Human (GRCh38)
Location 12:132178782-132178804
Sequence CCACCCTACACGTGTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104899124_1104899130 17 Left 1104899124 12:132178782-132178804 CCCACTTTACACGTGTAGGGTGG No data
Right 1104899130 12:132178822-132178844 GCCACAGGCAGCCCCCACCGGGG No data
1104899124_1104899133 24 Left 1104899124 12:132178782-132178804 CCCACTTTACACGTGTAGGGTGG No data
Right 1104899133 12:132178829-132178851 GCAGCCCCCACCGGGGGAGCCGG No data
1104899124_1104899127 2 Left 1104899124 12:132178782-132178804 CCCACTTTACACGTGTAGGGTGG No data
Right 1104899127 12:132178807-132178829 AGTCTGACAAACGCAGCCACAGG No data
1104899124_1104899132 18 Left 1104899124 12:132178782-132178804 CCCACTTTACACGTGTAGGGTGG No data
Right 1104899132 12:132178823-132178845 CCACAGGCAGCCCCCACCGGGGG No data
1104899124_1104899128 15 Left 1104899124 12:132178782-132178804 CCCACTTTACACGTGTAGGGTGG No data
Right 1104899128 12:132178820-132178842 CAGCCACAGGCAGCCCCCACCGG No data
1104899124_1104899129 16 Left 1104899124 12:132178782-132178804 CCCACTTTACACGTGTAGGGTGG No data
Right 1104899129 12:132178821-132178843 AGCCACAGGCAGCCCCCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104899124 Original CRISPR CCACCCTACACGTGTAAAGT GGG (reversed) Intergenic
No off target data available for this crispr