ID: 1104899339

View in Genome Browser
Species Human (GRCh38)
Location 12:132179927-132179949
Sequence CATTCCCTACAGCAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104899339_1104899354 21 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899354 12:132179971-132179993 CGGGGTTGCCTGGAGGTCGATGG No data
1104899339_1104899348 3 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899348 12:132179953-132179975 GAGAGTTCAAGCCCCTGGCGGGG No data
1104899339_1104899347 2 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899347 12:132179952-132179974 TGAGAGTTCAAGCCCCTGGCGGG No data
1104899339_1104899346 1 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899346 12:132179951-132179973 GTGAGAGTTCAAGCCCCTGGCGG No data
1104899339_1104899349 11 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899349 12:132179961-132179983 AAGCCCCTGGCGGGGTTGCCTGG No data
1104899339_1104899355 25 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899355 12:132179975-132179997 GTTGCCTGGAGGTCGATGGAAGG No data
1104899339_1104899356 28 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899356 12:132179978-132180000 GCCTGGAGGTCGATGGAAGGAGG No data
1104899339_1104899351 14 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899351 12:132179964-132179986 CCCCTGGCGGGGTTGCCTGGAGG No data
1104899339_1104899345 -2 Left 1104899339 12:132179927-132179949 CCCACCACCTGCTGTAGGGAATG No data
Right 1104899345 12:132179948-132179970 TGGGTGAGAGTTCAAGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104899339 Original CRISPR CATTCCCTACAGCAGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr