ID: 1104901423

View in Genome Browser
Species Human (GRCh38)
Location 12:132191285-132191307
Sequence GTCCCCGTGCTGGAGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104901423_1104901429 8 Left 1104901423 12:132191285-132191307 CCAGTGAGCTCCAGCACGGGGAC No data
Right 1104901429 12:132191316-132191338 AGCCAGTGAGCTCCAGCACGGGG No data
1104901423_1104901433 20 Left 1104901423 12:132191285-132191307 CCAGTGAGCTCCAGCACGGGGAC No data
Right 1104901433 12:132191328-132191350 CCAGCACGGGGACTGGTCACCGG No data
1104901423_1104901431 13 Left 1104901423 12:132191285-132191307 CCAGTGAGCTCCAGCACGGGGAC No data
Right 1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG No data
1104901423_1104901427 6 Left 1104901423 12:132191285-132191307 CCAGTGAGCTCCAGCACGGGGAC No data
Right 1104901427 12:132191314-132191336 CCAGCCAGTGAGCTCCAGCACGG No data
1104901423_1104901428 7 Left 1104901423 12:132191285-132191307 CCAGTGAGCTCCAGCACGGGGAC No data
Right 1104901428 12:132191315-132191337 CAGCCAGTGAGCTCCAGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104901423 Original CRISPR GTCCCCGTGCTGGAGCTCAC TGG (reversed) Intergenic
No off target data available for this crispr