ID: 1104901424

View in Genome Browser
Species Human (GRCh38)
Location 12:132191288-132191310
Sequence GTGAGCTCCAGCACGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104901418_1104901424 -8 Left 1104901418 12:132191273-132191295 CCTGCGGGCCGGCCAGTGAGCTC No data
Right 1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG No data
1104901411_1104901424 27 Left 1104901411 12:132191238-132191260 CCTGGCAGGTGGGGAGGACATGG No data
Right 1104901424 12:132191288-132191310 GTGAGCTCCAGCACGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104901424 Original CRISPR GTGAGCTCCAGCACGGGGAC TGG Intergenic
No off target data available for this crispr