ID: 1104901431

View in Genome Browser
Species Human (GRCh38)
Location 12:132191321-132191343
Sequence GTGAGCTCCAGCACGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104901423_1104901431 13 Left 1104901423 12:132191285-132191307 CCAGTGAGCTCCAGCACGGGGAC No data
Right 1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG No data
1104901418_1104901431 25 Left 1104901418 12:132191273-132191295 CCTGCGGGCCGGCCAGTGAGCTC No data
Right 1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG No data
1104901425_1104901431 3 Left 1104901425 12:132191295-132191317 CCAGCACGGGGACTGGTCACCAG No data
Right 1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG No data
1104901419_1104901431 17 Left 1104901419 12:132191281-132191303 CCGGCCAGTGAGCTCCAGCACGG No data
Right 1104901431 12:132191321-132191343 GTGAGCTCCAGCACGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104901431 Original CRISPR GTGAGCTCCAGCACGGGGAC TGG Intergenic
No off target data available for this crispr