ID: 1104902540

View in Genome Browser
Species Human (GRCh38)
Location 12:132197226-132197248
Sequence CCCCATTGTGAGCCGGGCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104902540_1104902550 19 Left 1104902540 12:132197226-132197248 CCGTGGCCCGGCTCACAATGGGG 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1104902550 12:132197268-132197290 ACATCAAGTCAGCCAGGTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 157
1104902540_1104902549 13 Left 1104902540 12:132197226-132197248 CCGTGGCCCGGCTCACAATGGGG 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1104902549 12:132197262-132197284 ACAGGCACATCAAGTCAGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 130
1104902540_1104902546 -10 Left 1104902540 12:132197226-132197248 CCGTGGCCCGGCTCACAATGGGG 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1104902546 12:132197239-132197261 CACAATGGGGCCACTCTGTGGGG 0: 1
1: 0
2: 0
3: 45
4: 357
1104902540_1104902547 -5 Left 1104902540 12:132197226-132197248 CCGTGGCCCGGCTCACAATGGGG 0: 1
1: 0
2: 1
3: 6
4: 130
Right 1104902547 12:132197244-132197266 TGGGGCCACTCTGTGGGGACAGG 0: 1
1: 0
2: 4
3: 34
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104902540 Original CRISPR CCCCATTGTGAGCCGGGCCA CGG (reversed) Exonic
900953434 1:5872592-5872614 CCACAGTGAGACCCGGGCCACGG + Intronic
902930143 1:19725505-19725527 CCCCCTTGTGATCAGGGCCCAGG + Intronic
904437497 1:30508171-30508193 CCCCAGTGTGAGAGGGACCAGGG - Intergenic
904701752 1:32362086-32362108 CAGCATTGTGACCCGGGCCGCGG + Exonic
906687067 1:47769610-47769632 CCCCATTGTGAGCCTAGGAAGGG - Intronic
906712311 1:47940080-47940102 CCACATGGTGATCAGGGCCAGGG - Intronic
916681829 1:167111974-167111996 GCCCAGTGTCAGCCAGGCCATGG + Intronic
920759206 1:208765744-208765766 CCCCATTGAGAAGAGGGCCAGGG - Intergenic
920821573 1:209386590-209386612 CCCCATTGGGAGCTGAGCCTTGG - Intergenic
1063155815 10:3378534-3378556 CCCCATGGTGAGCAAAGCCAAGG - Intergenic
1065820830 10:29523664-29523686 CCCCATCCTGAACCGAGCCAGGG - Exonic
1067378542 10:45751314-45751336 GCCCACTGTGGGCAGGGCCAGGG + Intronic
1067886237 10:50091994-50092016 GCCCACTGTGGGCAGGGCCAGGG + Intronic
1069534159 10:69240924-69240946 ACCCATTGTGTGCCGGCCCCTGG + Intronic
1069905595 10:71730449-71730471 CACCTGTGGGAGCCGGGCCAGGG - Intronic
1069908554 10:71746471-71746493 CACCATTGTGTGGCGGGCCTGGG - Intronic
1072615777 10:97048162-97048184 CCCCAGTGTCAGCCTGGGCAAGG - Intronic
1074854493 10:117463447-117463469 TCTCACTGTGAGCCAGGCCAAGG + Intergenic
1076034657 10:127188982-127189004 CTCCACTGTGAGCTGGGTCAGGG + Intronic
1076948204 10:133665677-133665699 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076949193 10:133668987-133669009 CCCCGGTGTGCGCCGGGCCTGGG - Intronic
1076950177 10:133672286-133672308 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076951162 10:133675585-133675607 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076952152 10:133678895-133678917 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076953140 10:133682205-133682227 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076955108 10:133741856-133741878 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076956098 10:133745166-133745188 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076957086 10:133748475-133748497 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076958075 10:133751785-133751807 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076959059 10:133755084-133755106 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1076960048 10:133758394-133758416 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
1079312513 11:19379030-19379052 CCCCAGTGTGTGCAGGGGCAGGG + Intronic
1083620078 11:64044888-64044910 CCCCACTGTGTGCTGGGCCTGGG + Intronic
1083694474 11:64433475-64433497 CTCCAGAGTGAGCCTGGCCATGG + Intergenic
1087145078 11:94802708-94802730 CCCCTTTGTGAACAGGGCCATGG + Intronic
1089202390 11:116732218-116732240 TCCCATTGTGCGCCAGGCCCAGG + Intergenic
1091784112 12:3231891-3231913 CCCCACTGAGAGCCAGGCCCAGG - Intronic
1092529349 12:9331756-9331778 CCCCATTGTCATTCTGGCCATGG - Intergenic
1092778118 12:11961801-11961823 CCCCATTTTGGTCCAGGCCAGGG - Intergenic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1103973774 12:124688819-124688841 CCCCTTTGTGAGCAGGCTCAGGG - Intergenic
1104902540 12:132197226-132197248 CCCCATTGTGAGCCGGGCCACGG - Exonic
1105897228 13:24726592-24726614 CTCTATTGTGAGGCTGGCCAAGG - Intergenic
1111211310 13:85083601-85083623 ACCCACTGTGATCTGGGCCAAGG - Intergenic
1112275835 13:98018497-98018519 CCCCATTGTCTGTCTGGCCATGG - Exonic
1113864391 13:113511658-113511680 CCCCATCGTGAGACTGGACAGGG + Intronic
1115880385 14:37910541-37910563 CCCCATTGGGAGGCAGCCCAAGG + Intronic
1117549303 14:56817702-56817724 CCCCAGTGTGAGCCAGGGCGCGG + Intergenic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1119765420 14:77184567-77184589 TCCCAGTGTGAGCCTGCCCATGG - Intronic
1123028820 14:105441040-105441062 CCCCATCCTGACCCAGGCCAGGG - Intronic
1123076363 14:105669309-105669331 CCCCTTTGTGCGCAGGGCCTGGG + Intergenic
1123091068 14:105742536-105742558 CCCCTTTGTGTGCAGGGCCTGGG + Intergenic
1124354368 15:28984153-28984175 CCCCACTGTGAGCCCCTCCAGGG - Intronic
1124880657 15:33639639-33639661 CCCCAGTGGGAGCTGGGCCATGG + Intronic
1127706605 15:61553252-61553274 CCCCAGTTTGAGCCTTGCCACGG - Intergenic
1127854852 15:62945878-62945900 CCCCCATGTGAGCTGGGCAAAGG + Intergenic
1128154008 15:65380753-65380775 CACCATTTTGAGCCGGGCGCAGG + Intergenic
1132522193 16:397075-397097 CCCCCGTGAGCGCCGGGCCACGG + Intronic
1136393176 16:29978036-29978058 CCCCATTGAGAGCCGGGCATGGG - Intronic
1137565280 16:49528842-49528864 ACCCAATGTGAGCCAGCCCATGG + Intronic
1141560425 16:84864144-84864166 CCCCATTCTGCTCCGGGCCAGGG - Intronic
1142638146 17:1270476-1270498 CCGCGTCGCGAGCCGGGCCAAGG + Intergenic
1142806288 17:2372780-2372802 TCCCACTGTGAGCTGGGGCACGG + Intronic
1144725913 17:17502756-17502778 CCCCATGGTGGGCGGGTCCAGGG - Intergenic
1146637794 17:34518978-34519000 CCCCAGTGTGACCTGGGCCCAGG + Intergenic
1148150458 17:45394005-45394027 CCCCATTGCCAACAGGGCCAGGG - Exonic
1151564282 17:74888925-74888947 CCCCATGGTGACCCAGGACAGGG + Intronic
1151872866 17:76848444-76848466 CCCCAGTGTGCGCTTGGCCAGGG - Intergenic
1163400030 19:17086452-17086474 CCCCAATACGAGCCGGGCCAAGG - Intronic
1163439009 19:17312231-17312253 GCCCTGTGTGAGCCCGGCCAGGG + Intronic
1163546728 19:17945149-17945171 CCCCACTGTGTGCCTGGCCTTGG + Intergenic
1163848703 19:19651660-19651682 CCCCACTGTGGGCCAGGCTAGGG + Intronic
1167675581 19:50882946-50882968 ACCCATTGTGAGATGGGCCTTGG - Intergenic
925089439 2:1141884-1141906 CCACATTGTGACAGGGGCCATGG + Intronic
932752762 2:74381922-74381944 CCCCATTGAGAGGTTGGCCAGGG + Intronic
942574443 2:177348662-177348684 CCCCATTGTGTGCTGGGCATTGG + Intronic
944933603 2:204545441-204545463 CCCCTTTAAGAGCCGGGCCCAGG + Intergenic
946946751 2:224829539-224829561 CCCCATTGTGGGTAAGGCCAAGG - Intronic
948468380 2:238162870-238162892 CCCCGCTGTGAGCAGGGCCTGGG + Intronic
1169084097 20:2816288-2816310 CCCCTTTGTGACCCGGGCTGGGG - Intronic
1170645413 20:18193004-18193026 CCACAGTGTGAGCCTGGGCAAGG + Intergenic
1175751872 20:61504203-61504225 CCCCAGTGTGTGGCCGGCCACGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1178633310 21:34281133-34281155 CCCCATGTGGAGACGGGCCAAGG - Intergenic
1180074520 21:45455926-45455948 CCCCACTGAGAGCTTGGCCAGGG + Exonic
1181752804 22:25001488-25001510 CCCCAATGTGGACCAGGCCAAGG + Intronic
1184523584 22:45009178-45009200 CCCCTTCGTGAGCCGGTCCCGGG - Intronic
954661460 3:52229045-52229067 CCCCATTTTCACCCGGGCCGCGG + Exonic
955325332 3:58005830-58005852 CCCTATTGTGAGCCAGGGCCGGG + Intergenic
961389356 3:126543039-126543061 CCCCATCGTGAGGCCAGCCAAGG - Exonic
962421288 3:135231129-135231151 CCCCTCTCTGAGCCAGGCCAGGG - Intronic
965165339 3:165189226-165189248 CCTCAGGTTGAGCCGGGCCAGGG + Exonic
967329288 3:188274539-188274561 CCCCATTGGGAGGAGGGGCATGG + Intronic
969531620 4:7733846-7733868 CCCCAGTGGGAGCCAGGTCAAGG + Intronic
969641424 4:8401418-8401440 CCCCATTGTCACCCGGTCCTGGG + Intronic
971230970 4:24800034-24800056 CTCCATCGTGGGCCGGGCCGTGG + Exonic
972872685 4:43319794-43319816 GCCCAGTGATAGCCGGGCCATGG + Intergenic
984046993 4:174813900-174813922 CCCCTTTGTGAGTCCCGCCAAGG - Intronic
984741752 4:183171195-183171217 CCTCATTGAGAGCAGGGTCAAGG + Intronic
985452648 4:190069777-190069799 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985453634 4:190073074-190073096 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985454624 4:190076367-190076389 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985455612 4:190079660-190079682 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985456596 4:190082954-190082976 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985457584 4:190086254-190086276 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985458571 4:190089547-190089569 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985459560 4:190092847-190092869 CCCCGGTGTGCGCCGGGCCTGGG - Intergenic
985521544 5:376145-376167 CCCCTTTGAGGGCTGGGCCAAGG - Intronic
985559198 5:573984-574006 CCCCAGGGAGAGCCGGGCCTGGG + Intergenic
986366910 5:7041615-7041637 CTGCATGCTGAGCCGGGCCACGG + Intergenic
988639525 5:33026038-33026060 CCCCATTGTGCCCAGGGACATGG - Intergenic
989175513 5:38521559-38521581 CCCCATTGTTAGTGGGTCCAAGG + Intronic
994516132 5:100774991-100775013 CCCCATTGTCAGGCGGACCGTGG + Intergenic
997263294 5:132479917-132479939 CTCCATTGTGATGGGGGCCAGGG + Intergenic
1002649707 5:180682330-180682352 CCCCATTGTGTGCGGGGAAACGG - Intergenic
1002840988 6:907156-907178 CCCCCTTGTGTGGCGGCCCAGGG - Intergenic
1006254023 6:32814982-32815004 CCCCCATGTGAACCTGGCCATGG - Intronic
1006389503 6:33750170-33750192 CCACATGGTGGGCCAGGCCAGGG - Intergenic
1012327454 6:97939947-97939969 CCACATAGTGAGAAGGGCCATGG - Intergenic
1014220766 6:118796465-118796487 ACCCAGTGTGAGCCGAGGCAGGG + Intergenic
1016353668 6:143194903-143194925 CCCCATTGTGAGCAGTACTACGG + Intronic
1018424344 6:163667150-163667172 CCCCACTGTGTGCCTGCCCAGGG + Intergenic
1022321593 7:29293242-29293264 GGCCATTGTCAGCAGGGCCAAGG - Intronic
1025161065 7:56661275-56661297 CCCCTTTATGAACCGGGCCCAGG - Intergenic
1025223884 7:57139934-57139956 GCCCCTTGTGGGCAGGGCCAAGG - Intergenic
1041523408 8:58779123-58779145 CCCCATTCTGATCCTGGGCATGG + Intergenic
1043345359 8:79291718-79291740 CCCCATTCTGAGCCAGGCCATGG - Intergenic
1046700328 8:117393201-117393223 ACCCATTGTGAGCTGGACCTGGG - Intergenic
1049216506 8:141410747-141410769 CCCCATTGTGAGCTGTGTGATGG - Intronic
1054707111 9:68473887-68473909 CCCCCATGTGAGCAAGGCCAGGG + Intronic
1057191049 9:93087923-93087945 CCCCATTGTGAAGCGGGACCAGG + Intergenic
1057767574 9:97935500-97935522 CCCCAGTGTCAGCAGTGCCAAGG + Intronic
1188588610 X:31806704-31806726 ACCCAGTGTGAGCAAGGCCATGG - Intronic
1190297678 X:49038215-49038237 CCCGATGGTGAGCAGCGCCATGG + Exonic
1192154394 X:68733073-68733095 CCCCCTTGTGGGCCCTGCCAGGG - Intergenic
1200102010 X:153692917-153692939 CCCCATTGTCCTCCGAGCCATGG - Intronic
1200236093 X:154468427-154468449 CACCATGGTGAGCGAGGCCACGG - Exonic