ID: 1104904203

View in Genome Browser
Species Human (GRCh38)
Location 12:132204841-132204863
Sequence ACCTGAGCACGGCGGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104904203_1104904208 3 Left 1104904203 12:132204841-132204863 CCCAAGCTCCGCCGTGCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1104904208 12:132204867-132204889 CAGCCCTGAGCCTGCCATGCTGG 0: 1
1: 0
2: 3
3: 57
4: 431
1104904203_1104904213 17 Left 1104904203 12:132204841-132204863 CCCAAGCTCCGCCGTGCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1104904213 12:132204881-132204903 CCATGCTGGACGAGTGTGCCAGG 0: 1
1: 0
2: 0
3: 7
4: 104
1104904203_1104904214 23 Left 1104904203 12:132204841-132204863 CCCAAGCTCCGCCGTGCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1104904214 12:132204887-132204909 TGGACGAGTGTGCCAGGCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 226
1104904203_1104904216 27 Left 1104904203 12:132204841-132204863 CCCAAGCTCCGCCGTGCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1104904216 12:132204891-132204913 CGAGTGTGCCAGGCCCAGGGCGG 0: 1
1: 0
2: 3
3: 20
4: 298
1104904203_1104904215 24 Left 1104904203 12:132204841-132204863 CCCAAGCTCCGCCGTGCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1104904215 12:132204888-132204910 GGACGAGTGTGCCAGGCCCAGGG 0: 1
1: 0
2: 0
3: 26
4: 264
1104904203_1104904217 28 Left 1104904203 12:132204841-132204863 CCCAAGCTCCGCCGTGCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1104904217 12:132204892-132204914 GAGTGTGCCAGGCCCAGGGCGGG 0: 1
1: 0
2: 6
3: 100
4: 654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104904203 Original CRISPR ACCTGAGCACGGCGGAGCTT GGG (reversed) Intronic