ID: 1104905286

View in Genome Browser
Species Human (GRCh38)
Location 12:132210154-132210176
Sequence CCCTGGGGCCCGTCGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104905282_1104905286 -7 Left 1104905282 12:132210138-132210160 CCAGAGATGGGTGGGTCCCTGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 141
1104905280_1104905286 -4 Left 1104905280 12:132210135-132210157 CCTCCAGAGATGGGTGGGTCCCT 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 141
1104905275_1104905286 20 Left 1104905275 12:132210111-132210133 CCAGAGATGGGAAAACAGGAGAC 0: 1
1: 1
2: 2
3: 29
4: 272
Right 1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104905286 Original CRISPR CCCTGGGGCCCGTCGTCTGC AGG Intronic
900800805 1:4735870-4735892 CCCTGGGGCCCGCCTCCTGAGGG + Intronic
901574628 1:10190972-10190994 ACCTGGGGCCCGTGGGCTGCAGG + Intergenic
902873642 1:19328497-19328519 CCCTGGGGGCCTTCGACTCCTGG - Intronic
903811071 1:26035392-26035414 CCAGGGGGCCCGGCGCCTGCCGG + Exonic
909256408 1:73429072-73429094 CACTGGGGCCTGTCGTGTGGTGG - Intergenic
913518261 1:119623275-119623297 CGCTGCGGCCCTTCGCCTGCGGG - Exonic
915264872 1:154709587-154709609 TCATGGGGCCTGTAGTCTGCTGG - Intronic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
920374638 1:205501291-205501313 CCCTGGGGCCCATCCCCTGTGGG - Intergenic
922565408 1:226598241-226598263 CCCAGGGGCCTGTGCTCTGCAGG + Intronic
924800930 1:247329407-247329429 CCCGGGGGCCCGCCGCCTCCTGG + Exonic
1068338319 10:55667316-55667338 CCCTGGGGCTGGTGGTCTGGGGG + Intergenic
1068475386 10:57517418-57517440 CACTGGGGCCTGTCGTCGGGGGG - Intergenic
1070736417 10:78866534-78866556 CCCTTGGCCCCGTCCTCTGGTGG - Intergenic
1070823772 10:79379342-79379364 GCCTGGGACCCATAGTCTGCTGG - Intergenic
1070917628 10:80165073-80165095 CCCTGGCCCCCGTCTTCAGCCGG - Intronic
1072899409 10:99394060-99394082 CCCCGGGGCCAGTGGTCAGCTGG - Exonic
1076246334 10:128950248-128950270 CCCTGGGGGCCCAGGTCTGCAGG - Intergenic
1076747232 10:132520416-132520438 CCCTGGGCCCCATCATATGCTGG - Intergenic
1077464239 11:2726040-2726062 GCCTGGGGCCCCTTCTCTGCCGG - Intronic
1078541696 11:12218260-12218282 CCCTGGGCCCCTGCCTCTGCTGG + Intronic
1079174105 11:18122343-18122365 CCCTGGGGCCTGTCGTGGGAGGG - Intronic
1083935332 11:65867022-65867044 CCCGGGGGCCCGTCACCGGCCGG + Exonic
1084416129 11:69033886-69033908 GCCTGGGGCTCATCGTCTGAGGG + Intergenic
1085273143 11:75282107-75282129 CCCTGGGGCCCTTGGTCTGATGG - Intronic
1086414404 11:86574477-86574499 CACTGAGGCCCCTCTTCTGCAGG + Intronic
1087007953 11:93487383-93487405 CCCTGTGGCCTGTCGGCAGCAGG - Intronic
1091221312 11:133931421-133931443 CCCTGGAGCCCTGGGTCTGCAGG - Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1091718508 12:2795827-2795849 CGCTGGGTCCCGGCGTCGGCAGG - Intronic
1093503388 12:19837157-19837179 CCCTGGGGCCTGTCGTGGGGTGG + Intergenic
1093763340 12:22935256-22935278 CCCTGGGGGCCGATGTCGGCAGG - Intergenic
1096623569 12:52879497-52879519 TCCTGGGGCCTGTCTGCTGCCGG + Intergenic
1097743151 12:63269213-63269235 CCCTGGGGCCTGTCGTGGGGTGG - Intergenic
1104792852 12:131494425-131494447 CCCTGGGCCCCTCCTTCTGCTGG - Intergenic
1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG + Intronic
1106819813 13:33452174-33452196 CCCAGGGGCACGAGGTCTGCTGG + Intergenic
1113803255 13:113097065-113097087 CCCTGCGGCCCCTCCTCTGTGGG - Exonic
1113922193 13:113919431-113919453 GCCTGGGGCCCGACACCTGCTGG - Intergenic
1116860995 14:49995582-49995604 CACTGTGGCCCCTCGCCTGCAGG + Intronic
1119745047 14:77038205-77038227 CCTTGGGGCGCGTGGTCTGGGGG - Intergenic
1121098465 14:91233892-91233914 CCCTGAGGCCCGTGGGCTGAAGG + Exonic
1122968998 14:105144873-105144895 CCCTGGGTCCCGTACTATGCAGG - Intronic
1129152154 15:73696036-73696058 CCCTGTGGCCCTGCTTCTGCAGG + Intronic
1129838530 15:78729094-78729116 CCCTTGGGCCCCCCGTCTCCAGG - Intergenic
1132081967 15:98874018-98874040 CCCTGCGGCGCTTCCTCTGCCGG + Intronic
1132657253 16:1046525-1046547 GCCTGGGGCCCGTGGTGGGCAGG + Intergenic
1141603289 16:85139005-85139027 CCCTGAGCCCCTTCGTCTACCGG - Intergenic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142142997 16:88480797-88480819 CCCTGGGGCCCACAGTCTGGGGG + Intronic
1143026449 17:3944492-3944514 CCCTGGGGCTCTTGGTCTGTGGG - Intronic
1151165727 17:72202023-72202045 CCCTGGGGCCTGTCGTGGGGTGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152002294 17:77654418-77654440 CCCTGGAGCTCGTGCTCTGCTGG + Intergenic
1152067003 17:78117544-78117566 CCCTGGGGCCTGCCGCCTCCAGG + Exonic
1153224724 18:2890786-2890808 CCCTGGTGCCCGTGTTCTACTGG - Exonic
1159227505 18:65558121-65558143 CCCTGGGGCCCGTTGTGAGGTGG + Intergenic
1160397052 18:78580244-78580266 CCCGGGGGCCCTTCATCTGCAGG - Intergenic
1160982429 19:1822543-1822565 CCTTGGGGCCCGCCGCCTGAAGG - Intronic
1161159999 19:2756641-2756663 CCCAGGGAGCCGGCGTCTGCTGG + Intronic
1161708602 19:5834411-5834433 CCCTGGGGCCAGTCCGCTGCTGG - Intronic
1162853303 19:13448576-13448598 CCCTGGGGGCTGGCTTCTGCTGG - Intronic
1165058863 19:33195159-33195181 CCCGGGGCCCCCTCGTCTCCAGG - Intronic
1165177283 19:33939442-33939464 CCCTGGGGCCCAGCGTCACCAGG - Intergenic
1165363837 19:35352068-35352090 GCCTGGGACCCGGCCTCTGCCGG + Exonic
1166384977 19:42375849-42375871 CCCCGGGGCCCACCATCTGCAGG - Exonic
1167604886 19:50476389-50476411 ACCTGGGGCCTGACGTCAGCAGG - Exonic
925181016 2:1816944-1816966 CTCTGGAGCACGGCGTCTGCAGG - Intronic
925975945 2:9142279-9142301 CCCTGGGCTCCGACATCTGCAGG - Intergenic
926721317 2:15963458-15963480 CACTGGGGCCTGTCGTGTGGTGG + Intergenic
927507938 2:23626740-23626762 CGCTGGGGCCCATCGCCTGCAGG - Intronic
928388239 2:30887954-30887976 ACCTGGGACCTGTAGTCTGCTGG + Intergenic
929915253 2:46129743-46129765 CCCTGGGCCCTGTAGTTTGCTGG - Intronic
930002692 2:46871648-46871670 CCCTGGGGCCCATCTGCTGGAGG + Intergenic
931489236 2:62726003-62726025 CCCTGTGTCCCTTGGTCTGCTGG - Intronic
933485866 2:82922931-82922953 CACTGGGGCCTGTCGTGTGGTGG - Intergenic
933710515 2:85322332-85322354 CCCTGGGGCCCGGGCTCTGTAGG - Exonic
935974064 2:108560093-108560115 CCCTGTGGCCCATCATCTGCTGG - Intronic
946188604 2:217995662-217995684 CCCCGGGGCCCTTCCTTTGCTGG + Intronic
947499305 2:230660435-230660457 GCCTTGGGCCAGTCTTCTGCAGG + Intergenic
948258268 2:236584145-236584167 CCCTGGGGTCTGCTGTCTGCAGG + Intergenic
948601136 2:239108061-239108083 CCCGGAGGCCCGTCTCCTGCAGG + Exonic
948637682 2:239349782-239349804 GCCTGGGGCCTGAAGTCTGCTGG - Intronic
948832473 2:240604909-240604931 CCCTGGGGCCCGTTTTATGTGGG + Intronic
1174035356 20:47665401-47665423 CCCTGGGGCCCGGGGAGTGCAGG - Intronic
1176365399 21:6029786-6029808 CCCTGGGGGGCCTCGCCTGCTGG + Intergenic
1176376172 21:6087804-6087826 CCCTGAGGCCAGTCCTGTGCTGG + Intergenic
1179747303 21:43450440-43450462 CCCTGAGGCCAGTCCTGTGCTGG - Intergenic
1179758119 21:43508759-43508781 CCCTGGGGGGCCTCGCCTGCTGG - Intergenic
1180190390 21:46160097-46160119 CCAGTGGGCCCCTCGTCTGCCGG + Intergenic
1183508294 22:38221187-38221209 CCCTGCTGCCCGTCCTGTGCTGG - Exonic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184234033 22:43173686-43173708 CCCTGGGGCTCCTGGTCTGCGGG + Intronic
1184333768 22:43841483-43841505 CCCTGGGGGCCCTCCTCTGAGGG - Intronic
1184690195 22:46113971-46113993 CTCTGGGGCGCGTCTGCTGCGGG + Intergenic
1184787699 22:46679892-46679914 CCCTGGGGCCCCACGGCTGCCGG + Intergenic
1185051505 22:48556611-48556633 CCCTGGGGGCTCTGGTCTGCAGG + Intronic
1185306718 22:50121738-50121760 CCCTGGGGACCCAGGTCTGCTGG + Intronic
951052576 3:18110882-18110904 CACTGGGGCCTGTCGTTGGCTGG + Intronic
952204362 3:31165162-31165184 CCCTGGGGCCTGTCGTGGGGTGG - Intergenic
952517094 3:34116235-34116257 CCCTGGGGCCTGTCGTGTAGTGG - Intergenic
956323991 3:68030420-68030442 CACTGGGGCCTGTCGGCTGGTGG - Intronic
963307401 3:143668316-143668338 CCCTGGGGCCTGTCGTGGGGTGG + Intronic
963355201 3:144202628-144202650 CACTGGGGCCCGTCGTGGGGTGG - Intergenic
968473055 4:790648-790670 CCCTGGGCTCCGGCCTCTGCTGG - Intronic
969455959 4:7299745-7299767 TCCTGGGGCCCGCTGCCTGCGGG + Intronic
972991303 4:44824874-44824896 CACTGGGGCCCGTCGTGGGGTGG + Intergenic
975936475 4:79587580-79587602 CACTGGGGCCTGTCGTGGGCTGG + Intergenic
981460708 4:145010658-145010680 CCCTGGGGCCTGTCGTGGGGTGG + Intronic
984888583 4:184473032-184473054 GCCTGGGGGCCGGCGTCCGCCGG - Intronic
985074904 4:186204794-186204816 CCCTGGTGCCCGTCATCAACAGG + Intronic
988370232 5:30359395-30359417 CACTGGGGCCTGTCGTGGGCTGG - Intergenic
990886891 5:60604728-60604750 CCCTGGGGTCCATGGTCTCCAGG - Intronic
992878825 5:81084816-81084838 CCCTGGGAGCTCTCGTCTGCGGG - Intronic
996782531 5:127203114-127203136 CCCTGGGGCCTGTCGTGGGGTGG + Intergenic
997806085 5:136919603-136919625 CTCTGGGGCCCGCTGTGTGCAGG - Intergenic
1001963655 5:175895325-175895347 CCCTGGGACCCCTTTTCTGCTGG - Intergenic
1002643515 5:180641608-180641630 TCCTGGGGCCAGGCCTCTGCAGG + Intronic
1003175667 6:3751115-3751137 CCCGGGCACCCCTCGTCTGCGGG + Intronic
1005846655 6:29785660-29785682 CACTGGGGCCTGTCGTCAGGTGG + Intergenic
1007153878 6:39723729-39723751 CCCTGGGGCCTGTCGTGGGGTGG + Intronic
1010006778 6:71003979-71004001 CACTGGGGCCTGTCGTGTGGTGG + Intergenic
1011406185 6:87017827-87017849 CCCTGGGGCCAGGAGGCTGCAGG + Intergenic
1018453507 6:163930865-163930887 CCCTGGGGCCTGTCGTGGGGTGG - Intergenic
1019144609 6:169968747-169968769 TCCTGGTGCCCGTCTTCTGTTGG - Intergenic
1019198645 6:170296619-170296641 CCCTGGGGGCCGGGGTCGGCGGG + Intronic
1019937937 7:4268480-4268502 CCCTGGGGCCCCTCGTTTTTTGG - Exonic
1020115388 7:5473314-5473336 CCCTGGAGCCCACCCTCTGCCGG + Intronic
1026590989 7:71695406-71695428 CCCAAGGGCCCTTCCTCTGCTGG - Intronic
1030945310 7:115711986-115712008 CACTGGGGCCTGTCGTGTGGTGG + Intergenic
1032515258 7:132502089-132502111 CTCTGGGGCCTGGCTTCTGCAGG - Intronic
1033037042 7:137884820-137884842 CCCTGGGGCCCCTCATCCACTGG - Intronic
1035362243 7:158321296-158321318 CCCTCAGGCCCCTCCTCTGCGGG + Intronic
1035598883 8:883038-883060 TCCTGGGTCCCGTGCTCTGCAGG + Intergenic
1036796320 8:11758893-11758915 CCCAGGGGCCCGTCGCATCCAGG - Exonic
1040541209 8:48357713-48357735 CCCTGGGGCCTGTCGTGGGATGG + Intergenic
1042855206 8:73260372-73260394 CCCTGGGGCCTGTCGTGGGGTGG + Intergenic
1049105632 8:140610692-140610714 CCCAGGGGCCTGTCGCCTTCAGG - Intronic
1049818346 8:144618962-144618984 CCTGGGGGCCCCACGTCTGCAGG - Intergenic
1056899114 9:90582426-90582448 CCCTGGGCCCTGTCCCCTGCAGG + Intergenic
1057917174 9:99065734-99065756 CCTTGGGGTCTGTCCTCTGCAGG + Intronic
1061872547 9:133528534-133528556 CACTGGGGCCTGCCATCTGCTGG - Intronic
1061913820 9:133738720-133738742 GCCAGGGGCCCGTCCACTGCAGG + Intronic
1062268028 9:135696247-135696269 CCCTGGGTCCCTGGGTCTGCTGG - Intronic
1062370765 9:136237472-136237494 ACCTGGAGCCCGTCCTGTGCCGG + Intronic
1062370772 9:136237499-136237521 ACCTGGAGCCCGTCCTGTGCCGG + Intronic
1185618660 X:1438937-1438959 CCCTTAGGCCCCTCATCTGCTGG + Intronic
1190682868 X:52843633-52843655 CACTGGGGCCTGTCGTGGGCTGG - Intergenic
1190980066 X:55449238-55449260 CCCTGGGGCCTGTCGTGGGGTGG + Intergenic
1192850513 X:74951100-74951122 CACTGGGGCCTGTCATCTCCAGG - Intergenic
1193376934 X:80772453-80772475 CCCTGGGGCCTGTCGTCGGGTGG + Intronic