ID: 1104908134

View in Genome Browser
Species Human (GRCh38)
Location 12:132226298-132226320
Sequence CAGTATGTGCAGCGTGTATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104908134 Original CRISPR CAGTATGTGCAGCGTGTATA TGG (reversed) Intronic
902879878 1:19364786-19364808 CAGTATGTGTAGCATGGATTAGG - Intronic
905990921 1:42335889-42335911 CAGTAGGTGGAGCGTTTAGAAGG + Intergenic
911404206 1:97415802-97415824 TAGCATGTGCAGCTTGTACAGGG + Intronic
911816074 1:102352950-102352972 GAGCAAGTGCAGCGTGTTTAGGG + Intergenic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
914382839 1:147134203-147134225 CAGTGTGTGCAGAGATTATATGG + Intergenic
921874446 1:220178136-220178158 CAGTATGTTCAGAGTGTTAAAGG + Intronic
1064458535 10:15510846-15510868 CAGGATGGCCAGCGTGTATTAGG - Intergenic
1065606814 10:27426820-27426842 CAGTGTGTTCAGCGTGTCTCTGG + Intergenic
1068996392 10:63210509-63210531 CAGTATGTGTCACATGTATATGG - Intronic
1074565417 10:114573129-114573151 CAGTATGGGCAGAGGATATAGGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078913641 11:15757405-15757427 CAGTATGCGCGGCGTGGGTATGG - Intergenic
1081489052 11:43553322-43553344 GAGTGAGTGCAGCGTGGATATGG + Intergenic
1081602434 11:44504630-44504652 GAGTATATGCAGGGTGTATGAGG - Intergenic
1094397901 12:30028036-30028058 AAGTATGTGAAGAGTATATAAGG + Intergenic
1104908134 12:132226298-132226320 CAGTATGTGCAGCGTGTATATGG - Intronic
1107055709 13:36101142-36101164 CAGTTTGTGCAGCGTATTGAGGG + Intronic
1108590915 13:51912225-51912247 CAGTGTGTGCAGCAGGTATTCGG + Intergenic
1110958196 13:81583625-81583647 CAGTATGTGAAGAATGTTTAGGG - Intergenic
1115250863 14:31345787-31345809 CAGTATGAGAAGTGTGTATGGGG + Intronic
1126207753 15:46064700-46064722 CTGGATGTGCAGTGTTTATAGGG - Intergenic
1131340843 15:91599221-91599243 CAGTATGTGCAGAGAGTCCAGGG - Intergenic
1137710868 16:50565999-50566021 CAGGATGTGCAGTGTGTGTCGGG - Intronic
1144071870 17:11681422-11681444 AAGTATGTGCAGCGTGGGCATGG - Intronic
1144945198 17:18966183-18966205 CAGTTTGTGCAGGGTGAATGTGG + Intronic
1162905824 19:13823336-13823358 CAGTATGGGCAGCCTGGGTAAGG - Exonic
1165354898 19:35298190-35298212 ATGTATGTGTAGTGTGTATAGGG - Intronic
925692784 2:6541949-6541971 GAGCATGCGCAGCGTGTTTAGGG + Intergenic
931694045 2:64859064-64859086 CAGTATTTGTAGCCTGTAGAAGG + Intergenic
934117963 2:88813711-88813733 CAGTATTGGCAGCGTGAAAATGG + Intergenic
935406171 2:102711922-102711944 CAGTATGTGCAGAGGTTGTATGG + Intergenic
937290108 2:120776858-120776880 CTGTGAGTGCAGCGTGTAGAGGG + Intronic
938241656 2:129747055-129747077 CAGTGTGTGCAGATTATATATGG + Intergenic
1170878392 20:20272554-20272576 CAGTATGTGCAGGGGGTGTCTGG - Intronic
1179481959 21:41684292-41684314 CAGGATGTGCTGCGTGGAAAAGG + Intergenic
1182991854 22:34775891-34775913 CACTATGTGCAGGGTTTTTATGG - Intergenic
1182996127 22:34814060-34814082 CATTATGAGTAGCATGTATACGG + Intergenic
1183574849 22:38681725-38681747 CATTCTGTTCAGCGGGTATAGGG - Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
950372445 3:12542570-12542592 CAGGATGTGTAGCCTGGATATGG - Intronic
954445565 3:50544990-50545012 CAGTAATTGCAGAGTATATATGG - Intergenic
957761626 3:84566291-84566313 CAGTATGTGCAAGGTGTAATGGG - Intergenic
959557091 3:107733040-107733062 CAGTATGAGCAGAGTGGAGACGG - Intronic
960268768 3:115651324-115651346 CCGTATGTGCAGAGTGTGCATGG - Intronic
966087610 3:176088179-176088201 GAGTATGTGCAGCTTCTCTAGGG + Intergenic
966861351 3:184232633-184232655 CAGTGTGTGCAGTGTGCAAATGG + Intronic
971727658 4:30334462-30334484 CATTATGTGCAGTATTTATAAGG - Intergenic
982384328 4:154782851-154782873 CAGGATATGTTGCGTGTATAAGG + Intronic
983767186 4:171499193-171499215 CAGTATGTGAAGTGTGTTCATGG - Intergenic
994294823 5:98078281-98078303 CAGTAATAGCTGCGTGTATAGGG + Intergenic
995926661 5:117383039-117383061 GAGTATGTGCAGCGTGTTTATGG + Intergenic
996764508 5:127022480-127022502 CAGTATGTGCAAAGTGTAAGAGG + Intronic
1000195232 5:158950738-158950760 CAGCATGTGGAGAGTGTATTTGG + Intronic
1008123374 6:47642918-47642940 GTTTATGTGCAGGGTGTATAAGG + Intergenic
1009374124 6:62946695-62946717 GAGCATGTGCAGTGTGTTTAGGG - Intergenic
1012856987 6:104513714-104513736 CAGTATGTGCAGCGATCACATGG - Intergenic
1024862388 7:53860853-53860875 CAGTATCTGCAATGTGTATCAGG - Intergenic
1030253584 7:107480680-107480702 TAGTATGTGCAGCCTGTCAATGG - Intronic
1035630014 8:1100110-1100132 CAGCATGTACAGTGTGTGTAGGG + Intergenic
1058278227 9:103074751-103074773 GAGCATGTGCAGTGTGTTTAGGG + Intergenic
1058732908 9:107867659-107867681 CAGGATGTGCAGCATATATAGGG - Intergenic
1190540919 X:51477829-51477851 CTTTATGTGCAAGGTGTATAAGG - Intergenic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1201288139 Y:12396453-12396475 GAGCATGTGCAGTGTGTTTAGGG - Intergenic