ID: 1104908468

View in Genome Browser
Species Human (GRCh38)
Location 12:132228192-132228214
Sequence CTGCATGAGTGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104908468_1104908474 6 Left 1104908468 12:132228192-132228214 CCCTCTGCCCTCCACTCATGCAG 0: 1
1: 0
2: 3
3: 24
4: 331
Right 1104908474 12:132228221-132228243 GACACCCCCGCGTCCCTCCCCGG 0: 1
1: 0
2: 3
3: 56
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104908468 Original CRISPR CTGCATGAGTGGAGGGCAGA GGG (reversed) Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901789609 1:11647435-11647457 TTTCAGGAGAGGAGGGCAGAGGG + Intergenic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
902380171 1:16049009-16049031 CTGCAGGAGAGCAGGACAGATGG + Intronic
902648685 1:17822576-17822598 CTGCCTGATTAGAGGGCACAAGG - Intronic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
904013830 1:27405639-27405661 ATGCATAAGTGGAGCCCAGAGGG + Exonic
904828258 1:33289493-33289515 GTGCATGGGAGGAGGCCAGAGGG + Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905275434 1:36814748-36814770 CTAGATAAGTGGAGGGCAGATGG - Intronic
905897392 1:41557669-41557691 CTCCAGGGGTGGGGGGCAGAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907048278 1:51313302-51313324 CTGCAGGAGGTGGGGGCAGAAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
907947971 1:59153169-59153191 TTGCAAGAGTGGAAGCCAGAGGG - Intergenic
909597473 1:77422590-77422612 GTGCATGAGTAGAGGTCACACGG - Intronic
909959320 1:81819344-81819366 CTGCTTTAGTGGAAGGGAGAAGG + Intronic
913491031 1:119380126-119380148 CTGCATGAGAGGATTCCAGAAGG - Intronic
915065293 1:153219835-153219857 CTCCATGGGTGGGGGGCAGCAGG - Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
915249182 1:154576422-154576444 CTGCTTGAGTGGACAGCAGCTGG + Exonic
916477600 1:165185255-165185277 CTGAATTAGTTGAGGGCAGTAGG - Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
920729530 1:208469998-208470020 GTGTATGAGAGCAGGGCAGATGG - Intergenic
921448408 1:215273545-215273567 CAGCATGAGATGAGGGCAGTAGG - Intergenic
922966494 1:229695166-229695188 CTGCAGCAGTGCATGGCAGAAGG - Intergenic
923000846 1:230005214-230005236 CCTCATGATGGGAGGGCAGAAGG - Intergenic
923557707 1:235013723-235013745 CTGGAAGAGGGGTGGGCAGATGG + Intergenic
924134477 1:240949369-240949391 GTGGATGAGTGGATAGCAGATGG - Intronic
924380755 1:243462104-243462126 CTGCATCAGTGTAGCACAGAGGG + Intronic
1062863501 10:829150-829172 CTGCATGACAAGAGGGGAGACGG + Intronic
1063592377 10:7407378-7407400 GTGCAAGAGTGGAGGGGGGATGG + Intronic
1063979744 10:11443995-11444017 CTGCATTCCTGGGGGGCAGAGGG + Intergenic
1064305730 10:14164356-14164378 CTACATGAGAGGAGAGCACAGGG - Intronic
1065860728 10:29870550-29870572 ATGAATGAGTGGATGGTAGATGG - Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067840084 10:49668737-49668759 CAGCAGGAGTGGAGGGGAAAGGG + Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1069729188 10:70600185-70600207 CTGGATGAGAGGAGGCCACAGGG + Intronic
1069878585 10:71578026-71578048 CTCCTTGGGTGGAGGACAGAGGG - Intronic
1069951966 10:72025223-72025245 CTCCCAGACTGGAGGGCAGAAGG + Intergenic
1071072271 10:81708614-81708636 ATGCATGAGTGGAAGCCGGAGGG - Intergenic
1072943752 10:99790932-99790954 AAGCATGAGGGGAGGGGAGATGG + Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1080589290 11:33707579-33707601 CCAGATGAGTGGAGGGCACAGGG + Intronic
1080844162 11:36011952-36011974 CTGCATGACTGTGGGGAAGAAGG + Intronic
1083134288 11:60657080-60657102 CTCCATGAGGGGAGGGATGAGGG - Intergenic
1084322524 11:68381551-68381573 CTGCATGCGTGCAGGGAGGAAGG + Intronic
1084699752 11:70778802-70778824 CTGCCAGTGTGGAGGGCAGTAGG - Intronic
1085619956 11:78030605-78030627 GTGAGTGAGGGGAGGGCAGAAGG - Intronic
1086263524 11:84970363-84970385 CTGAATGAATGAATGGCAGATGG - Intronic
1086966331 11:93031926-93031948 CTGCTGGAGTAGAAGGCAGATGG + Intergenic
1087272397 11:96124756-96124778 GGGCATGAGAGGAGGGAAGAAGG + Intronic
1088205985 11:107393191-107393213 CTGCATAAGTGATGGGCACATGG - Intronic
1088826207 11:113496403-113496425 CTGCAAGAGTGAGGAGCAGAAGG + Intergenic
1088835128 11:113571449-113571471 CTGCATGAGTAGACTGGAGAAGG + Intergenic
1089458784 11:118640883-118640905 CTTTAAGAGTGGAGGGCAGGAGG + Intronic
1089735432 11:120547376-120547398 CTGCACGAGCGGAGTACAGAGGG + Intronic
1090385686 11:126356391-126356413 CTGCATGGGTGGTGAGCAGTGGG + Intronic
1090964407 11:131585440-131585462 CTGCAGGAAAGGAGGGTAGAGGG + Intronic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1091980884 12:4862833-4862855 CCGCATGAGTGGAAAACAGAGGG - Intergenic
1093010358 12:14100982-14101004 TTGTTTGAGTGGAGGGCAGAGGG + Intergenic
1094004439 12:25733701-25733723 CAGAATCAGTGGAGGCCAGAAGG - Intergenic
1095382112 12:41607407-41607429 CTGAATGAATGGAGGGGAGGGGG + Intergenic
1097896009 12:64825194-64825216 CTGGAAGGGTAGAGGGCAGACGG + Intronic
1100448033 12:94679023-94679045 CAGAATGACTGCAGGGCAGAGGG - Intergenic
1101044338 12:100789082-100789104 TTCCATGAGTGGTGGGAAGAAGG - Intronic
1101099803 12:101380493-101380515 TTGAATGAGTGGAGGGTAGAAGG + Intronic
1101444952 12:104730982-104731004 CTGCAGCAGTCCAGGGCAGAAGG - Intronic
1102214574 12:111151578-111151600 CTGAATGCGTGGAGGGCAGACGG + Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1105006571 12:132724695-132724717 CCGCATGAGGGGAAGGCTGAGGG + Intergenic
1105592139 13:21802251-21802273 GCGAATGAGTGGAGTGCAGATGG + Intergenic
1105761009 13:23514424-23514446 CTGCATGACAGGTGTGCAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1108696832 13:52909595-52909617 ATGGAAGAGTGGAGGGCAGGAGG + Intergenic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109237616 13:59843944-59843966 CTGTATGAGTGGCGGGCAGGAGG + Intronic
1109611013 13:64764595-64764617 CTGCATGTATTGAGAGCAGAGGG - Intergenic
1109718371 13:66246199-66246221 CTGCAGGAGTGGAGCACAGATGG + Intergenic
1110542441 13:76721188-76721210 CTGCATGGGTGGAGGGGATATGG - Intergenic
1112916886 13:104562436-104562458 CTCCCAGAGAGGAGGGCAGAGGG - Intergenic
1113309997 13:109121951-109121973 CTTCATCAGTGCAGGGGAGAGGG + Intronic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1118723637 14:68611141-68611163 GTGCATCTGTGGAGGGCACATGG - Intronic
1119405639 14:74397120-74397142 CTGCAAGTGTGAAGGGCTGAAGG + Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1120662665 14:87269288-87269310 CTGCCTGTGTAGAGGCCAGATGG + Intergenic
1121054675 14:90842893-90842915 CTGCATGAGATGTGGGCAGAGGG - Intergenic
1121598141 14:95181550-95181572 TTGCATCATTTGAGGGCAGAGGG - Intergenic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1122538911 14:102485763-102485785 CTGGATGAGTGCAGCCCAGAGGG - Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1126101452 15:45120505-45120527 CCACATGAGTGGAGGAGAGATGG + Intronic
1126398616 15:48246013-48246035 CTGCATGATTGGTGAGCAGAGGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1128781403 15:70361209-70361231 GGGCATGAGTGGAAGGCAGGTGG - Intergenic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1129198318 15:73983996-73984018 CTACATGAGTGGACGGCTGAAGG - Exonic
1129529116 15:76248273-76248295 GTGCATTAGTGGAGGAGAGAGGG + Intronic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129785413 15:78306854-78306876 CCGCAGGAGGGGAGGGAAGAGGG - Intergenic
1130059558 15:80559753-80559775 GTGCCTGAGTGGAGAGGAGACGG - Intronic
1131335102 15:91541360-91541382 CAGCTTGAGTTGAGGGCAGTGGG + Intergenic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1133017814 16:2952698-2952720 CTGCGTGAGTGAGGGGCTGAGGG - Intergenic
1133017828 16:2952769-2952791 CTGCATGTGTGAGGGGCTGAGGG - Intergenic
1133017843 16:2952840-2952862 CTGCGTGAGTGCCGGGCTGAGGG - Intergenic
1133712862 16:8418217-8418239 CTACATGAGTGGAGGGTGGGAGG + Intergenic
1134411359 16:14005036-14005058 CTGCATGACTGGAGGTGGGAAGG + Intergenic
1138030195 16:53553659-53553681 CTCCAAGATTGGAGGGCTGAAGG + Intergenic
1138391104 16:56670342-56670364 CAGCATGAATGGAGAGGAGATGG + Intronic
1138852489 16:60645600-60645622 CTCCTTGAGTGGACTGCAGAGGG - Intergenic
1138972022 16:62156693-62156715 CTGCAAGAGATGAGGTCAGAAGG + Intergenic
1140747418 16:77993486-77993508 CTACAGGATTGGTGGGCAGATGG - Intergenic
1141331274 16:83113688-83113710 GTGCTTGAGTGGAGAGTAGAAGG + Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142113122 16:88342517-88342539 CTACCTGAGTGCAGGGCAGTGGG - Intergenic
1142493448 17:293246-293268 CTGCATGAGTGGCAGGCGGAGGG - Intronic
1142878712 17:2868129-2868151 CTGCTGGGGTGGAGGGCAGCTGG - Intronic
1143063923 17:4228339-4228361 CTGCAGAAGTGGATGGCAAAAGG + Intronic
1143381269 17:6497845-6497867 CTGCATGGGGGTGGGGCAGAGGG + Intronic
1144433017 17:15212514-15212536 CTGCAGGGGTGAAGGGGAGATGG + Intergenic
1144965945 17:19077499-19077521 CTTCATAACTGGAGGACAGATGG - Intergenic
1144982023 17:19174690-19174712 CTTCATAACTGGAGGACAGATGG + Intergenic
1144986200 17:19203549-19203571 CTTCATAACTGGAGGACAGATGG - Intergenic
1145392137 17:22463583-22463605 ATACATGAGTTGATGGCAGATGG + Intergenic
1146004957 17:29155330-29155352 CTGCATGTGTGGTGGGGAGGAGG - Intronic
1147896337 17:43754203-43754225 GTCCGTGAGTGGTGGGCAGAAGG + Exonic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148807708 17:50272551-50272573 CTGCAGGGGAGGAGGGGAGACGG + Intronic
1149845572 17:60007553-60007575 AGACATGAGTGGAAGGCAGAGGG + Intergenic
1150916397 17:69441962-69441984 CAGCATCAGTGGAGGCCAGATGG - Intronic
1151563773 17:74885604-74885626 GTGCAGGAGTGGTGGGCAGCAGG - Intronic
1152003469 17:77662110-77662132 CTGAAGGAGTGGAGGGGACAAGG - Intergenic
1152256677 17:79244022-79244044 CTTCATGTGTGGAAGGCCGAGGG - Intronic
1152336945 17:79703951-79703973 CTGCAGGAGTGGGGGGTAGGAGG + Intergenic
1152811650 17:82385442-82385464 CCCCATGCGGGGAGGGCAGAGGG - Intergenic
1154191465 18:12234301-12234323 CTTCCTTAGTCGAGGGCAGATGG + Intergenic
1154302122 18:13203444-13203466 CTGATTGAGAGCAGGGCAGAAGG + Intergenic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1154426437 18:14275593-14275615 CTCCACGAGTGCAGTGCAGAAGG - Intergenic
1155908363 18:31479222-31479244 CTGGATGAGGTCAGGGCAGAGGG + Intergenic
1156093436 18:33499542-33499564 TTGGATGAATGGAGGGCAGCTGG + Intergenic
1156491708 18:37500208-37500230 CTGCCTGGGTGGACGGCAGGCGG + Intronic
1156585444 18:38426347-38426369 CTGCATGTGTTGGGGGAAGATGG + Intergenic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1158284998 18:55870586-55870608 GTGAATGAATGGCGGGCAGAAGG - Intergenic
1158409889 18:57196457-57196479 TTGCATGACTGGAAGGCACATGG - Intergenic
1158675236 18:59512504-59512526 ATGGATGAGTTGAGGGCAGTGGG - Intronic
1158905293 18:62005742-62005764 CTGCAAGAGTGGAGGCCTCATGG - Intergenic
1158937324 18:62376532-62376554 GTGCATGTGTGGGGGGCAGGAGG - Intronic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161242377 19:3229475-3229497 CCGCAGGAGTGGAGGCCAGGAGG + Intronic
1161633657 19:5373398-5373420 CTGGATGAATGGATGGCACATGG + Intergenic
1161949214 19:7458489-7458511 CTGCATGAGTAGAGGGCATTGGG - Intronic
1163005300 19:14393660-14393682 CTGCCTGAATGCAGGGCAGGAGG - Intronic
1163171258 19:15532822-15532844 CTGGATGAGGGGAGGGCAAGAGG - Intronic
1163555241 19:17988396-17988418 CTCCCTGTGTGCAGGGCAGAGGG - Exonic
1165031177 19:32999128-32999150 GTGCATGGGTGGTGCGCAGAGGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165242243 19:34478119-34478141 CTGCAACAGGGGAGGACAGAGGG + Intergenic
1166101909 19:40576270-40576292 CTTCATGAGGGGAGGGGCGAGGG + Exonic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166305138 19:41933043-41933065 CTGCAGAATTGGTGGGCAGATGG + Intergenic
1166759969 19:45218168-45218190 CTGCCTGAGGGGAGGGGAGGTGG - Intronic
1167169752 19:47823248-47823270 ATGAATGAATGAAGGGCAGAAGG + Intronic
1167240549 19:48340717-48340739 CTGCAACCATGGAGGGCAGAGGG - Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925451093 2:3969704-3969726 CTGCATCTGTGGGGGGCAGCAGG - Intergenic
926851398 2:17201720-17201742 ATGCTTGAGGGGAGGACAGATGG + Intergenic
926914039 2:17876751-17876773 CTGCAGGAGCTGAGGACAGAAGG - Intergenic
927888004 2:26730360-26730382 TTGCAGGTGTGGTGGGCAGAGGG - Exonic
928121391 2:28586305-28586327 CTATAGGAGCGGAGGGCAGAGGG - Intronic
929136116 2:38625311-38625333 TTGCATGAGAAGAGGGCTGAAGG - Intergenic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931322602 2:61185768-61185790 CTGAATAATTGGAGGGGAGATGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
936729655 2:115365230-115365252 CTGCATGACAGCGGGGCAGATGG + Intronic
941461089 2:165772784-165772806 CAGCATAAGTGGAAGGCACAGGG + Intronic
944863752 2:203840477-203840499 ATGCATGAGGGGAGGGCTGTGGG + Intergenic
945623756 2:212173749-212173771 CTGGATGAAAGGAGGTCAGAGGG + Intronic
946301040 2:218824196-218824218 GGGCATGAATGGAGGGCACACGG + Intronic
946474641 2:219995675-219995697 CTGCGTGTGTGGTGTGCAGAGGG + Intergenic
946724867 2:222652305-222652327 CTGAATCAGTGGAGGTTAGAGGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
947778201 2:232732082-232732104 TTGCATGACTGGTGGGGAGAGGG - Intronic
948068095 2:235097160-235097182 CTGCTTGGCTGCAGGGCAGAGGG + Intergenic
948249118 2:236511485-236511507 CTGCAGGAGTGGAGGAGAGGAGG + Intergenic
948279946 2:236739252-236739274 GTGGATGAGTGGGGGGTAGATGG + Intergenic
948673324 2:239582591-239582613 CTGCTTGAATGGGGGGCGGAGGG - Intronic
948716906 2:239871023-239871045 CTGAAGGAGCGGAGGGGAGAGGG + Intergenic
948815640 2:240509046-240509068 ATGGATGAGTGGAGGGTAGATGG + Intronic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1170121453 20:12916892-12916914 CTGCATGAGTAGTCAGCAGATGG - Intergenic
1171096537 20:22337417-22337439 CTGCATTTGCGGAGGGCAGTTGG + Intergenic
1171343298 20:24446989-24447011 CTGCCTGAGTGGAGGACACCTGG - Intergenic
1172385993 20:34534609-34534631 ATGCCTGAGGGGAGAGCAGACGG - Exonic
1172683692 20:36737265-36737287 CTTCAGGAGTGGAAGGCAGGGGG - Intronic
1172957349 20:38770664-38770686 GTGCATGAGTGTAAGGCACATGG - Intronic
1173419313 20:42886888-42886910 CTCCATGGGCGGAGGGCAGGAGG + Intronic
1174379900 20:50149723-50149745 CAGCATGTGTGCAGGGCAGGTGG - Intronic
1174856472 20:54050194-54050216 CTTCATGAGAGGGAGGCAGAAGG - Intronic
1175339301 20:58217962-58217984 CTTCTTGAGTCGGGGGCAGAAGG - Intergenic
1175424141 20:58853663-58853685 CTCCATGAGTGCTGGGCCGAAGG - Exonic
1175919331 20:62442672-62442694 CTGCATTTGTGGGGGCCAGAGGG + Intergenic
1176523611 21:7847604-7847626 TTACATGAATGGATGGCAGATGG + Intergenic
1176666786 21:9695238-9695260 TTGCATGGGTGAAGGGCAGCAGG + Intergenic
1177746394 21:25219668-25219690 CTGCATTGATGGAGGGTAGAAGG - Intergenic
1178657631 21:34477616-34477638 TTACATGAATGGATGGCAGATGG + Intergenic
1178781481 21:35607000-35607022 GTGCATGAGTGGAAGGCAGTAGG + Intronic
1178968949 21:37154002-37154024 CTGCTTTAGGGGAGGGCAGGGGG - Intronic
1179340859 21:40507885-40507907 ATGCAGGAGTGGAGGGGCGAGGG - Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1181151160 22:20884437-20884459 CTGCAGGTGATGAGGGCAGAAGG - Intronic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
949733704 3:7145759-7145781 CTGTCTGAGTGGAGGCCACAAGG - Intronic
950043388 3:9934059-9934081 CTGAAGGAGAGGAGGCCAGAGGG - Intronic
950203784 3:11062655-11062677 CTCCCTGAGGGGAGGGCAGCGGG - Intergenic
950395993 3:12734543-12734565 CTGCAAGGATGGAAGGCAGAGGG - Exonic
950668464 3:14511311-14511333 CTGCATGAGTCGGGGGCAGAGGG + Intronic
950952333 3:17013665-17013687 CTGCATTATTTGAGAGCAGAAGG + Intronic
952509079 3:34036102-34036124 ATGCATGTGTGAAGGACAGAAGG + Intergenic
953507247 3:43498344-43498366 TTGCAGGGGTGGAGGGCAGTTGG - Intronic
954149572 3:48650671-48650693 CAGCAGGAGTGGCGGGCAGTGGG - Intronic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
955340157 3:58118994-58119016 GTGCCTGAATGGAGAGCAGATGG + Intronic
956192434 3:66620654-66620676 GTGGATGAGTGGCAGGCAGATGG - Intergenic
956627716 3:71283084-71283106 CAGCACCAGTGGAAGGCAGATGG - Intronic
957277193 3:78105835-78105857 CTGCATGAGTGGAAGAAAGTAGG + Intergenic
957931824 3:86888456-86888478 CTACTTGAGTGGAGGGCTTAGGG + Intergenic
958088388 3:88843164-88843186 CTGGAAGAGTGGAGGACAGGAGG + Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959387704 3:105732769-105732791 CTGCATGAGTTGAGGAAGGATGG - Intronic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
959948243 3:112149779-112149801 CTGCCTGGGTGGGGAGCAGAGGG + Intronic
961145218 3:124587366-124587388 CTGCATGACTGGAAGTCAGATGG - Intronic
962082746 3:132157787-132157809 CTGCATATGGGGAAGGCAGAAGG - Intronic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
963094109 3:141517399-141517421 CTACATGAGTGAAAGGCAAAGGG + Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
967787188 3:193510000-193510022 ATGCATGAATGGAGGGGAGAAGG + Intronic
967877465 3:194276976-194276998 CTCCAAGACAGGAGGGCAGATGG - Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
968436472 4:592963-592985 GTGCATGAGTGAAGGGCACCAGG - Intergenic
968565532 4:1310725-1310747 ATGTCTGAGTGGAGGGCAGCTGG + Intronic
968620052 4:1599957-1599979 CTGCATCAGGGGAAGGGAGAGGG - Intergenic
969652777 4:8477765-8477787 CTGCAGGACTGGGGGGCCGAGGG - Intronic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
970365542 4:15354436-15354458 CTGGATGTGGGGAGGCCAGATGG + Intronic
970380142 4:15499118-15499140 CTGAATGGGTGGAGCACAGAAGG + Intronic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
976132143 4:81896073-81896095 ATCCATGAGTGGGGGGCAGCAGG - Intronic
983003905 4:162458246-162458268 CTTCCTGACTGGAGGACAGATGG + Intergenic
983347599 4:166546513-166546535 TTACACCAGTGGAGGGCAGAGGG + Intergenic
984918415 4:184743475-184743497 TTGGGTGAGGGGAGGGCAGAGGG + Intergenic
985232473 4:187835885-187835907 AGTCATGAGTGGAGGTCAGATGG - Intergenic
985524403 5:394769-394791 CTGGTTGCGTGGAGGGCAGAGGG + Intronic
985711984 5:1434503-1434525 CAGCCTGACTGGTGGGCAGATGG + Intronic
985721139 5:1489859-1489881 CTGGAAGAGAGGAGGGGAGACGG + Intronic
986751763 5:10793995-10794017 CTGCATGTTTGCAGAGCAGATGG - Intergenic
990416995 5:55596311-55596333 CTGCATGTGGGGAGGAAAGATGG + Intergenic
990621478 5:57564263-57564285 CTCCATGAGGGTAGGGCACATGG + Intergenic
991483163 5:67105524-67105546 CTGCATCAGTGGACTGCAGTTGG - Intronic
991515656 5:67432229-67432251 TTGCATGAGTGTTGGGCCGAGGG + Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992733233 5:79692784-79692806 ATGGATGAATGGTGGGCAGAAGG - Intronic
996098636 5:119425217-119425239 CTCCATGAGTGAGAGGCAGAGGG + Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
997088315 5:130826939-130826961 CTGCAGGAGTGGAGTCCACATGG - Intergenic
997260330 5:132460803-132460825 CTGCATGAGAGCAGGGCTGATGG - Exonic
997599943 5:135132291-135132313 CTGCATGGGTGGTGGGAAGTGGG - Intronic
997748068 5:136317301-136317323 ATGAATGAGTGAATGGCAGATGG - Intronic
999088090 5:148911091-148911113 CTGCATTGTGGGAGGGCAGATGG - Intergenic
1000368259 5:160510868-160510890 CAGCATCAGTGGGGAGCAGACGG - Intergenic
1001324553 5:170712590-170712612 CTGCATGACTGCATGGCTGAGGG + Intronic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1004082197 6:12405851-12405873 CTGCATGTGTGGAGATCACATGG + Intergenic
1005864892 6:29929861-29929883 TTGCATGAGAGGAGAGTAGATGG + Intergenic
1006200666 6:32287064-32287086 CTGCATCAATGGAAGGGAGATGG + Intergenic
1006515908 6:34545418-34545440 CTGCTTGTGTTGAGGCCAGATGG - Intronic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007096120 6:39214348-39214370 CTGCATGGATGACGGGCAGAGGG + Intronic
1007926958 6:45657473-45657495 CTGCTTGAGTGGAGTTCTGAAGG - Intronic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1014732137 6:125045188-125045210 CTGCATGATGGAAGAGCAGATGG - Intronic
1017828855 6:158106147-158106169 CTTCATTAATGGAAGGCAGAAGG - Intergenic
1017989195 6:159471377-159471399 CTGCAGCAGTGCAGGGCAGTGGG + Intergenic
1018735896 6:166686964-166686986 CTGACTGGGTGCAGGGCAGAGGG + Intronic
1019360484 7:602104-602126 AAGCCTGAGTGGAGGGGAGACGG - Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1022043563 7:26603787-26603809 CTGCATTAGTCATGGGCAGAGGG + Intergenic
1023754962 7:43407798-43407820 CTCCATGAATGGAGGGAAGGAGG - Intronic
1023995376 7:45156327-45156349 CTGCCTGAGGGGTGGGCAGCAGG - Intergenic
1026421614 7:70242967-70242989 CTGAATGTGTGGAAGGCAGTAGG - Intronic
1028672732 7:93422143-93422165 ATGCATGAGTGCAGTGAAGAAGG + Intergenic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1031978789 7:128110855-128110877 CTACCTGAGTGGGGAGCAGAGGG - Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035899969 8:3448647-3448669 CAGCATGAGTGGAGGCCAAGTGG + Intronic
1036646978 8:10617061-10617083 CTGCCCAAGTGGAGGGGAGAGGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1037444949 8:18956090-18956112 CTGAATGAATGGAAGGAAGAAGG + Intronic
1040907577 8:52485126-52485148 CTCCATGAGTGAGGAGCAGATGG + Intergenic
1040981935 8:53252726-53252748 CTCCATCAGCGGAGGGCAGAAGG + Intergenic
1041430681 8:57777838-57777860 CTGCATGGGTGGAGCCCACATGG + Intergenic
1047906032 8:129474159-129474181 CTGCAGGTGTGGGGGGCAGCAGG + Intergenic
1047960871 8:130010790-130010812 CTGAATGAATGAAGGGGAGAGGG + Intronic
1049064359 8:140301187-140301209 CTGCATGCGAGTAGAGCAGAGGG - Intronic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1049414056 8:142487424-142487446 CAGCCCCAGTGGAGGGCAGAGGG - Intronic
1050577434 9:7011848-7011870 CGGCATGAGCAGAGTGCAGATGG - Exonic
1051086002 9:13349748-13349770 CTGCATGTGTGGGGGGGACAGGG - Intergenic
1052238661 9:26245729-26245751 CTGAATATGTGGAGGGCAGTGGG + Intergenic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053434256 9:38065149-38065171 ATCCATGAGTGAGGGGCAGAAGG + Intronic
1054454363 9:65421971-65421993 GTGGATGAGTGGATGGAAGATGG + Intergenic
1055673161 9:78627410-78627432 CTGCAAGAGCAGAGGGGAGAGGG - Intergenic
1056950319 9:91036312-91036334 CCCCAGGAGGGGAGGGCAGAAGG - Intergenic
1057141687 9:92730136-92730158 TTCCATGGGTAGAGGGCAGACGG + Intronic
1057838938 9:98469544-98469566 CTGTATGAGAGAAAGGCAGAGGG - Intronic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1061266071 9:129505730-129505752 CTCCAGGAGAGGAGGGCAGGGGG - Intergenic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1062366620 9:136212633-136212655 CGGCAGGAGAGCAGGGCAGACGG - Intronic
1062579911 9:137224911-137224933 TTGCCTGAGAGGAGGGCAGGAGG - Exonic
1203659311 Un_KI270753v1:26523-26545 TTGCATGGGTGAAGGGCAGCAGG - Intergenic
1186598052 X:11006147-11006169 GTGGATGAGAGGAGGGAAGAAGG - Intergenic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1188106672 X:26155588-26155610 CCCCATGTGTGGAGGGCAGGAGG - Intergenic
1190137101 X:47807304-47807326 ATGCATAAGTGGAGCCCAGAGGG - Intergenic
1195129579 X:101839829-101839851 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195176660 X:102320000-102320022 AGGCAGGAGTGGAAGGCAGAGGG + Intronic
1195182204 X:102367093-102367115 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195254926 X:103081610-103081632 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195270070 X:103220512-103220534 CAGCTAGAGTGGAGGCCAGAGGG + Intergenic
1197156499 X:123275557-123275579 CTGCATGGATCTAGGGCAGAAGG + Intronic
1198503020 X:137271318-137271340 CTGCCTGTGTGGAGTTCAGAGGG + Intergenic
1199149744 X:144416378-144416400 CTGAATGAAAGCAGGGCAGAAGG - Intergenic
1199512858 X:148642166-148642188 CTGCAGGAGTGCATGGTAGAAGG + Intronic
1200137585 X:153882584-153882606 CTGCCTGGCTGGAGGGCAGGGGG + Intronic