ID: 1104908602

View in Genome Browser
Species Human (GRCh38)
Location 12:132228671-132228693
Sequence TGCCTTCCGTGTGCAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104908591_1104908602 13 Left 1104908591 12:132228635-132228657 CCCCCCAGCGGAGTGGGGTCTCG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1104908594_1104908602 10 Left 1104908594 12:132228638-132228660 CCCAGCGGAGTGGGGTCTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1104908596_1104908602 9 Left 1104908596 12:132228639-132228661 CCAGCGGAGTGGGGTCTCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1104908593_1104908602 11 Left 1104908593 12:132228637-132228659 CCCCAGCGGAGTGGGGTCTCGAG 0: 1
1: 0
2: 0
3: 11
4: 80
Right 1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1104908592_1104908602 12 Left 1104908592 12:132228636-132228658 CCCCCAGCGGAGTGGGGTCTCGA 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104908602 Original CRISPR TGCCTTCCGTGTGCAAGAGG AGG Intronic
900386490 1:2413201-2413223 TGCCTCCCGTGGGCACCAGGGGG - Intronic
915181441 1:154064518-154064540 AGCCTTCCCTGTTCAAGACGAGG + Intronic
920648452 1:207819868-207819890 TGCCTTCCTCGTACAAGAGGAGG - Intergenic
921317477 1:213905691-213905713 TGCCTTCCCTTTGGAAAAGGGGG + Intergenic
923876198 1:238050675-238050697 TGCCTTCCCTGTCCAAAAGTGGG + Intergenic
924365100 1:243284593-243284615 TGCATTCCGTGTGGGAGAGGGGG - Intronic
924377066 1:243422078-243422100 TCTTTTCAGTGTGCAAGAGGTGG - Intronic
1065441163 10:25755004-25755026 TGCCTCCCGGGTTCAAGCGGTGG - Intergenic
1065760387 10:28976332-28976354 TGGCTTCAGTGTGCAAGCAGTGG - Intergenic
1067164730 10:43856307-43856329 AGCCTACCGTGTGCTAGATGGGG + Intergenic
1067758703 10:49026638-49026660 TGCCCTCCGTGTGGAAAAAGAGG + Intronic
1073175835 10:101556942-101556964 TTCCTTCAGTGTCCAAGAAGGGG - Exonic
1074418502 10:113287790-113287812 AGCCTTCAATGTGCTAGAGGGGG + Intergenic
1074708255 10:116155347-116155369 TTCCTTCCCTCTGCTAGAGGGGG - Intronic
1076978787 11:194408-194430 TGCCTTCCAGGTGCAAGTGCTGG + Exonic
1081970525 11:47195191-47195213 TCTGTTCCGAGTGCAAGAGGGGG + Intergenic
1089309646 11:117549177-117549199 GGGCTTCTGTGTGCAGGAGGAGG - Intronic
1089578027 11:119460388-119460410 TGCCTTCTGTCTGTAAGAAGGGG - Intergenic
1089871939 11:121682646-121682668 TGCCTCCCGGGTCCAAGAGCTGG - Intergenic
1090831615 11:130424622-130424644 TGGCTTCCATTTGCAGGAGGTGG + Intronic
1090920814 11:131204426-131204448 TGCCTGCTGCCTGCAAGAGGAGG - Intergenic
1091703656 12:2679752-2679774 TGCCATCCGGGTGCAGGAGGTGG + Exonic
1092033336 12:5308589-5308611 TGCCTGCTGTGTGCAAGACCTGG + Intergenic
1097499005 12:60378478-60378500 TGCCTTGCTGATGCAAGAGGTGG - Intergenic
1103157252 12:118696533-118696555 TGACTTTTGTGTGCATGAGGGGG + Intergenic
1104287423 12:127437124-127437146 TTCCTGCCTTGTGCCAGAGGTGG + Intergenic
1104908602 12:132228671-132228693 TGCCTTCCGTGTGCAAGAGGAGG + Intronic
1112325964 13:98443032-98443054 AGCCTTCCGTGTGCATGATCAGG + Intronic
1113694689 13:112336069-112336091 TGCCTTCTGAGTGCAGGGGGTGG - Intergenic
1115631789 14:35252732-35252754 TGTTTTCTGTGTGCAACAGGAGG - Intronic
1117118876 14:52547696-52547718 TGCCTTATGTGTTCAACAGGGGG + Intronic
1119363501 14:74071492-74071514 TGACTTCTGTGTTCCAGAGGTGG - Exonic
1120144363 14:80963381-80963403 TGCCTTACAGGTGTAAGAGGAGG - Intronic
1123828610 15:24108594-24108616 AGCCTTCAGAGTGCAAAAGGAGG - Intergenic
1123858598 15:24438384-24438406 AGCCTTCAGAGTGCAAAAGGGGG - Intergenic
1125708805 15:41766779-41766801 CGTCTTCCAAGTGCAAGAGGAGG - Exonic
1126165312 15:45649928-45649950 TGCCTCCCGGGTTCAAGTGGGGG + Intronic
1127248640 15:57206672-57206694 AGCCTTCCGAGTACAGGAGGTGG - Intronic
1128026739 15:64443890-64443912 GGCTTTCAGTGTGGAAGAGGTGG - Intronic
1129111237 15:73338540-73338562 TGCCTACCATGTGCTAGTGGTGG - Intronic
1129790799 15:78339720-78339742 CGCGTTCCGAGTGCAGGAGGGGG - Intergenic
1131059441 15:89395582-89395604 TGCCTGCTGTGAGCAGGAGGAGG - Intergenic
1132629999 16:912686-912708 TGGCTTCCGTGGGGAAGATGGGG - Intronic
1133976305 16:10601878-10601900 TGCCTACTGTGTGCAACACGGGG - Intergenic
1134214788 16:12308572-12308594 TGCCTTCCGTGTGCTAGTCACGG + Intronic
1138231217 16:55337817-55337839 TACCTTCAGTGTGGAAGAAGAGG + Intergenic
1138677188 16:58660060-58660082 TGCCTTCCATGTGCCTGAGCAGG + Intergenic
1140354418 16:74293148-74293170 TCCCTACCCTGTGCAAGAGTAGG - Intergenic
1141700450 16:85639817-85639839 TGCTTGCCGTGTGCAGCAGGCGG + Intronic
1142466217 17:138900-138922 TGCCTTCCAGGTGCAAGTGCTGG + Exonic
1145123878 17:20284414-20284436 TGCTGTCCGTGTGCAGGACGAGG + Intronic
1145232509 17:21184377-21184399 TGCCCTCCATGATCAAGAGGAGG + Exonic
1148128090 17:45247105-45247127 TGCCCTCTGTGGCCAAGAGGAGG - Exonic
1155035361 18:22021020-22021042 TGCCTACTGTGTGCAAGGTGTGG + Intergenic
1155397079 18:25397970-25397992 TGCCTTTCCTGTGCTTGAGGTGG - Intergenic
1155437289 18:25826523-25826545 TGCCTTTCCTTTCCAAGAGGTGG + Intergenic
1157369681 18:47099338-47099360 TGCCTCCTGTGAGCAAGAGCAGG + Exonic
1163780332 19:19243611-19243633 CGCCTCCCGGGTTCAAGAGGCGG - Intronic
1166607070 19:44152830-44152852 TGCCTCCCCTGTGCCAGAGGTGG + Intronic
1166893071 19:46006501-46006523 TGCCCTCCGTGTGGCAGTGGCGG + Intronic
1168310826 19:55459737-55459759 TTCCTCCCCTGTGCAGGAGGCGG + Intronic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
936239428 2:110774136-110774158 TCCCTTCCGTGTGCCAGGTGAGG + Intronic
947310509 2:228796635-228796657 TGCTTTCAGAATGCAAGAGGTGG - Intergenic
948166477 2:235866539-235866561 TGCCATCAGTGTGCTGGAGGGGG + Intronic
949021492 2:241743531-241743553 TGGCTTGCCTGTGCAAGATGGGG + Intronic
1169275134 20:4228669-4228691 TGCTTTCCCTGTGAAACAGGAGG - Intronic
1169778018 20:9277120-9277142 TTCCTTCCGTGTGGGAGAAGTGG + Intronic
1170430210 20:16268603-16268625 TTCCTTCCTTCTGCAAGAGTGGG + Intergenic
1171405992 20:24912860-24912882 TGCCTCCCGCATGCAAGAGCAGG - Intergenic
1171416770 20:24986849-24986871 TGCCTGCCAAGAGCAAGAGGAGG + Intronic
1174240921 20:49133845-49133867 TGCCTGCCATGGGCCAGAGGTGG - Intronic
1178942223 21:36915540-36915562 TGCCCTACGTGTGCAAGGAGAGG + Intronic
1182083143 22:27543355-27543377 TCCCCTCAGTGGGCAAGAGGAGG - Intergenic
1183058316 22:35320283-35320305 AGCCTTCAGGGTGCAAGTGGGGG + Intronic
1183832172 22:40424096-40424118 TGGCTTCCCTGTGCCAGAGCAGG + Intronic
1185083168 22:48720945-48720967 TGACTTCACTGTGCATGAGGGGG - Intronic
953225320 3:41013631-41013653 TGTCTTCCTTGTGCATCAGGTGG - Intergenic
953902283 3:46850112-46850134 TGCAGTCCGTCTTCAAGAGGGGG - Intergenic
959626429 3:108457267-108457289 TGCCTTCTCCGTGCAGGAGGGGG + Intronic
960024306 3:112990843-112990865 TGCCTTCAGTGCGCGGGAGGAGG - Intergenic
969564091 4:7967495-7967517 TGCCATCCGAGAGCAGGAGGTGG + Intronic
970826702 4:20285069-20285091 TGTCTTCCCTGTACAAGGGGTGG + Intronic
975439962 4:74399315-74399337 TGCCTGCCCTGAGCAATAGGGGG - Intergenic
977994387 4:103484644-103484666 TGGCTTCCCTTTGCTAGAGGAGG - Intergenic
982088236 4:151857983-151858005 TGCTTTCCGTGAGCCAGATGTGG - Intergenic
982442579 4:155454139-155454161 TGACTTCCATCTGCAATAGGAGG - Intergenic
983907281 4:173197154-173197176 TGCCTTCTCTGTGCAAGTGCTGG + Intronic
985150296 4:186940283-186940305 TGACTTCAGTGTGCAAGAAATGG + Intergenic
985168616 4:187124482-187124504 AGACTTCTGTGTGCAGGAGGTGG - Intergenic
990864723 5:60368193-60368215 AGCCTTCTGTCTGCAGGAGGAGG - Intronic
995795379 5:115936135-115936157 TGCCTTCAGCAGGCAAGAGGAGG - Intergenic
997239013 5:132293775-132293797 TGTTTTCCCTGTGCAAGATGAGG + Intronic
1000759985 5:165210882-165210904 TCCCTTCTGTGGGCAAGAAGTGG - Intergenic
1003926817 6:10884075-10884097 TGCCTTCGGTTGGCAAAAGGCGG + Intronic
1005152809 6:22772313-22772335 TGCCTTGGGTGGGTAAGAGGAGG - Intergenic
1006022151 6:31123630-31123652 TGCCTTCCATAGGCAAAAGGTGG + Intronic
1012177870 6:96111253-96111275 TGCCTGCCGTGGGGTAGAGGTGG - Intronic
1013054862 6:106573856-106573878 TGCCTTCCTTGTGCCAGCTGAGG + Intronic
1014645725 6:123970183-123970205 TGCCTTCTTTGTGGAAGAAGAGG + Intronic
1018038376 6:159900829-159900851 TGCCTACTGTGTGCAAGTGTTGG + Intergenic
1018841513 6:167520865-167520887 TGCCTGTCGTGTGCTAGATGCGG + Intergenic
1028981686 7:96974180-96974202 TGCATTCCGAGGGCATGAGGAGG + Intergenic
1029171001 7:98628891-98628913 TGCCTTCCTGCTGCAAGTGGAGG + Exonic
1037529486 8:19758755-19758777 TGCCCTCCGTCTGCAAAATGGGG - Intergenic
1038335002 8:26638936-26638958 TGCCTTCCATGTGTGAGTGGTGG + Intronic
1038503355 8:28063524-28063546 TGCCTTCCTCCTGCAGGAGGTGG + Intronic
1042014496 8:64292997-64293019 TGCCTTCCCTGAGATAGAGGAGG - Intergenic
1043443081 8:80294127-80294149 TGCCTCCCGGGTTCAAGTGGTGG + Intergenic
1043614191 8:82104963-82104985 TGCCTCCCCTGTGCAAGCTGCGG - Intergenic
1045277397 8:100721019-100721041 CTCCTTCCGTGGGTAAGAGGTGG - Intronic
1051543757 9:18250699-18250721 TGCCTTGCTCGTGGAAGAGGGGG + Intergenic
1052173766 9:25432479-25432501 GGGCATCCCTGTGCAAGAGGTGG + Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1055164954 9:73179974-73179996 TGCTTTCTGTGTGCTAGATGTGG - Intergenic
1058753072 9:108058385-108058407 TGCCTACTGTGTGCAAAAGGTGG + Intergenic
1060205344 9:121679646-121679668 TGCCTGCTGTGTGCAAGCAGAGG + Intronic
1062097006 9:134708688-134708710 TCCCTTCCAGGGGCAAGAGGAGG - Intronic
1062138573 9:134943189-134943211 TGCCTGCCGGCTGCAAGGGGGGG - Intergenic
1188759649 X:34011254-34011276 GGGCTTCCGTGTGCTGGAGGAGG - Intergenic
1189131857 X:38507396-38507418 TGCCTGCCCTGTGCAGGAAGGGG + Intronic
1189333172 X:40155233-40155255 TGCCTTCCGTCTGCGAGAGCCGG - Intronic
1199012239 X:142771010-142771032 TGGCTTCCGTTAGCTAGAGGAGG + Intergenic