ID: 1104911077

View in Genome Browser
Species Human (GRCh38)
Location 12:132241216-132241238
Sequence GTATAGGGAGGGCCCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 5, 1: 37, 2: 11, 3: 17, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104911077_1104911086 9 Left 1104911077 12:132241216-132241238 CCTTCCAGGGGCCCTCCCTATAC 0: 5
1: 37
2: 11
3: 17
4: 150
Right 1104911086 12:132241248-132241270 ACACGCCACACCCCCTTCCCGGG 0: 29
1: 9
2: 8
3: 35
4: 272
1104911077_1104911087 10 Left 1104911077 12:132241216-132241238 CCTTCCAGGGGCCCTCCCTATAC 0: 5
1: 37
2: 11
3: 17
4: 150
Right 1104911087 12:132241249-132241271 CACGCCACACCCCCTTCCCGGGG 0: 28
1: 9
2: 10
3: 24
4: 163
1104911077_1104911085 8 Left 1104911077 12:132241216-132241238 CCTTCCAGGGGCCCTCCCTATAC 0: 5
1: 37
2: 11
3: 17
4: 150
Right 1104911085 12:132241247-132241269 CACACGCCACACCCCCTTCCCGG 0: 28
1: 9
2: 12
3: 25
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104911077 Original CRISPR GTATAGGGAGGGCCCCTGGA AGG (reversed) Intronic
901050607 1:6424253-6424275 GGATCTGGAGGGACCCTGGAAGG + Intronic
901781779 1:11599004-11599026 GGAGAGGGAGGGGTCCTGGAGGG + Intergenic
901820615 1:11826965-11826987 GAATAGGCAGGGATCCTGGAAGG - Intronic
903569488 1:24293877-24293899 GTTTGGGGAGGGCCCCAGCAGGG - Intergenic
904616711 1:31753949-31753971 TTTTAGGGAGGGCCCCTGTAGGG - Intronic
905215107 1:36401237-36401259 GTGGAGGGTGGGCCCCCGGAAGG + Intergenic
905253762 1:36666574-36666596 GTACAGGGAGGACTCCTGGAAGG - Intergenic
905462413 1:38130299-38130321 TCATAGGGAAGGCCCCTGGAGGG + Intergenic
905708019 1:40076848-40076870 GTACAGGGAGGTCTCCTGTAAGG + Exonic
906248861 1:44296013-44296035 GTTTAGGGAGGGGGCCAGGAAGG + Intronic
907386945 1:54132103-54132125 GGATGGTGAAGGCCCCTGGATGG + Intergenic
908280637 1:62530973-62530995 GTATAGGGAGGGTCGGTGGGTGG + Intronic
908412129 1:63877526-63877548 GTAAAGGGATTGGCCCTGGAGGG + Intronic
910659475 1:89655860-89655882 GTATATGGAGGGCTCCTTTAAGG + Intronic
915268370 1:154734472-154734494 GTACAAGGAAGCCCCCTGGAAGG + Intronic
915941572 1:160121516-160121538 GTATAGGGAAGGGCCCTGCCTGG - Intronic
919420428 1:197363856-197363878 GTATAGGAAGGGAACGTGGAAGG + Intronic
919611652 1:199752442-199752464 GTACAGGGAGTTCTCCTGGAGGG + Intergenic
920847543 1:209606664-209606686 GCATAGGCAGGGACTCTGGAGGG - Intronic
922822625 1:228494508-228494530 GCACAGGGAGGGCTCCTGGGAGG - Exonic
924547509 1:245043715-245043737 GTGCAGGGACGGCCCCAGGAAGG + Intronic
924939430 1:248802512-248802534 CTATAGGCAGGACCCGTGGAAGG - Intergenic
1069821030 10:71228945-71228967 GTGTAGGGTGGGCTCATGGAAGG - Intronic
1071273984 10:84036019-84036041 GTGTTGGGAGGGCCACAGGAAGG - Intergenic
1071319446 10:84438504-84438526 CTATAGGGAGAGCCTCTGGAAGG - Exonic
1073276786 10:102318680-102318702 GTTTAGGGAGGGGACCTTGAAGG - Intronic
1075554915 10:123423391-123423413 GCAGAGGGAGGACCCATGGAGGG + Intergenic
1077366352 11:2162850-2162872 GTGTAGGGAGGGAGGCTGGATGG + Intergenic
1078858191 11:15223708-15223730 ATATAGGGAGGTGGCCTGGAAGG + Intronic
1079349390 11:19679913-19679935 CAAGAGGAAGGGCCCCTGGAGGG + Intronic
1081615270 11:44587154-44587176 GTTTAGGGAGGGCCTTTGGGAGG + Intronic
1081638450 11:44736568-44736590 GAATAGGGGGGGTCCCTGGGAGG + Intronic
1082038753 11:47667404-47667426 ATGTCCGGAGGGCCCCTGGAAGG + Intronic
1083222062 11:61258971-61258993 GTAGAGTGGGGGCTCCTGGAGGG + Exonic
1083309509 11:61777209-61777231 GGATAGGGAGGGGACCTGCAGGG - Intronic
1084929370 11:72542289-72542311 GTAGGGTGAGGGCACCTGGAGGG - Intergenic
1086018063 11:82191606-82191628 GTAAAGGGAGGGAGCCAGGATGG + Intergenic
1086566635 11:88234227-88234249 ATGTAGGGAAGGCCCCAGGATGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091058194 11:132438554-132438576 GTATAGGGTGGGCAGCAGGAAGG + Intronic
1092245211 12:6860302-6860324 GTCTAAAGAAGGCCCCTGGATGG + Intronic
1096652986 12:53071224-53071246 GTCTGGGGAGGACCCCTGGGAGG + Intronic
1104910948 12:132240811-132240833 GTATAGGGACGGCCTTGGGAAGG - Intronic
1104910962 12:132240856-132240878 GTATAGGGACGGCCCTGGGAAGG - Intronic
1104910975 12:132240901-132240923 GGATAGGGAGGGCCCCGGGAAGG - Intronic
1104910992 12:132240946-132240968 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911008 12:132240991-132241013 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911021 12:132241036-132241058 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911034 12:132241081-132241103 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911047 12:132241126-132241148 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911061 12:132241171-132241193 GGATAGGGAGGGCCCTGGGAAGG - Intronic
1104911077 12:132241216-132241238 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911092 12:132241261-132241283 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911107 12:132241306-132241328 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911122 12:132241351-132241373 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911138 12:132241396-132241418 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911154 12:132241441-132241463 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911168 12:132241486-132241508 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911183 12:132241531-132241553 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911199 12:132241576-132241598 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911214 12:132241621-132241643 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911230 12:132241666-132241688 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911243 12:132241711-132241733 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911258 12:132241756-132241778 GGATAGGGAGGGCCCCGGGAAGG - Intronic
1104911275 12:132241801-132241823 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911290 12:132241846-132241868 GGATAGGGACGGCCCCTGGAAGG - Intronic
1104911304 12:132241891-132241913 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911320 12:132241936-132241958 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911335 12:132241981-132242003 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911351 12:132242026-132242048 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911367 12:132242071-132242093 GTATAGGGAAGGCCCCGGGAAGG - Intronic
1104911382 12:132242116-132242138 GTACAGGGAAGGCCCCGGGAAGG - Intronic
1104911394 12:132242161-132242183 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911410 12:132242206-132242228 GTATAGGGAAGGCCCCGGGAAGG - Intronic
1104911425 12:132242251-132242273 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911441 12:132242296-132242318 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911457 12:132242341-132242363 GTATAGGGAAGGCCCCGGGAAGG - Intronic
1104911472 12:132242386-132242408 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911485 12:132242431-132242453 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911501 12:132242476-132242498 GTATAGGGAAGGCCCCGGGAAGG - Intronic
1104911516 12:132242521-132242543 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911532 12:132242566-132242588 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911548 12:132242611-132242633 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911564 12:132242656-132242678 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911580 12:132242701-132242723 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911596 12:132242746-132242768 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911612 12:132242791-132242813 GTATAGGGAAGGCCCCGGGAAGG - Intronic
1104911627 12:132242836-132242858 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911643 12:132242881-132242903 GTATAGGGAAGGCCCCGGGAAGG - Intronic
1104911655 12:132242926-132242948 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911671 12:132242971-132242993 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911687 12:132243016-132243038 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911703 12:132243061-132243083 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911719 12:132243106-132243128 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911735 12:132243151-132243173 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911749 12:132243196-132243218 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1104911765 12:132243241-132243263 GTATAGGGAGGGCCCCGGGAAGG - Intronic
1106121426 13:26862943-26862965 GTGTAGGGAGGGCCCATGAGTGG + Intergenic
1114451648 14:22830299-22830321 CTAGAGGGAACGCCCCTGGACGG + Intronic
1115555464 14:34541921-34541943 GAAAAGGGAGGACCACTGGACGG - Intergenic
1115558444 14:34561172-34561194 GAAAAGGGAGGACCACTGGACGG + Intronic
1117434161 14:55700352-55700374 GGCTAGGGAGGGCTCCTAGAAGG + Intronic
1118662400 14:68028722-68028744 GGTCAGGGAGGGGCCCTGGAAGG + Intronic
1119265150 14:73259967-73259989 GCAGAGGGAGGGCACCTGGCAGG - Intronic
1122347128 14:101067536-101067558 GCAGAGGGAGGGGCACTGGAGGG - Intergenic
1122594157 14:102877717-102877739 GTTGAGGGAGGGCCTGTGGAAGG - Intronic
1122631953 14:103111354-103111376 GTGCAGGGAGGGGGCCTGGAGGG - Intergenic
1128880495 15:71237781-71237803 GTGTAGGGAGGGAGACTGGATGG + Intronic
1129523632 15:76200816-76200838 GTTGAGGGAGGGCCCCGGGCTGG - Intronic
1130901517 15:88210216-88210238 GAATAGGGAGGGCCTCTCAAAGG + Intronic
1131154850 15:90068420-90068442 GTAGAGGGTGGGGCCCTGGTGGG - Exonic
1132472409 16:112950-112972 GTCTATGGATGGGCCCTGGAGGG - Intronic
1136561930 16:31044379-31044401 CTATAGGGAGGGGCCCAGCAGGG - Intergenic
1136777290 16:32878766-32878788 GGAAAGGCAGGCCCCCTGGAGGG + Intergenic
1136893335 16:33982747-33982769 GGAAAGGCAGGCCCCCTGGAGGG - Intergenic
1137337653 16:47566167-47566189 GTATTGGGATGGCCCATGCAGGG - Intronic
1138233837 16:55362929-55362951 CCATAGGGAGAGCTCCTGGATGG - Intergenic
1138329793 16:56204429-56204451 GGAGAGGGAGGGCCCAGGGAAGG + Intronic
1203079704 16_KI270728v1_random:1140875-1140897 GGAAAGGCAGGCCCCCTGGAGGG + Intergenic
1143584761 17:7845572-7845594 GTGCAGCGCGGGCCCCTGGAGGG - Exonic
1143588377 17:7864089-7864111 GTTTAGGGAGGCCACATGGATGG + Intronic
1144653012 17:17018891-17018913 GTCTAGGGAGGGGCCCTGGAGGG - Intergenic
1145063545 17:19747311-19747333 ACATAGGGAGGGACCATGGAAGG - Intronic
1146438280 17:32871869-32871891 GTATAGGAATGGCCCATGTAAGG + Intronic
1147043993 17:37739623-37739645 GTCTAGTGAGGACCCTTGGAGGG - Exonic
1147364488 17:39951383-39951405 GGATTGGGAGGGACCCAGGAGGG - Intergenic
1148657775 17:49301078-49301100 GTATAAGAAGGGGTCCTGGAGGG - Intronic
1149250162 17:54759245-54759267 GTATAGGGTGAGCCCCTGTAGGG - Intergenic
1150822558 17:68447201-68447223 GGATAGCAAGGGCCCCTGGGAGG + Intronic
1151277069 17:73043148-73043170 GAACAGGGAGGGGCTCTGGAAGG + Intronic
1152399958 17:80059916-80059938 GTAAAGGGAGGGCCCGGGGCTGG + Intronic
1152910268 17:83000950-83000972 GTGTGGGGAGGGCTCCGGGATGG + Intronic
1154127814 18:11708317-11708339 GCATAGGGAGGGCCCAGGAAAGG + Intronic
1159601054 18:70429233-70429255 GTACAGGGAGGGCCACTGGCTGG + Intergenic
1160939940 19:1615521-1615543 CTATGGGGAGGGCGCCGGGAGGG + Intronic
1162012887 19:7829038-7829060 ATGTAGGGATGGGCCCTGGAGGG - Intergenic
1163374371 19:16921430-16921452 GGGCAGGGAGGGCCCCTGGGAGG - Intronic
1164678487 19:30118793-30118815 GAATAGGGAGGGACCCTGGAGGG - Intergenic
1166931361 19:46303544-46303566 GGACAGGGAGGGCCCCTGCTGGG - Intronic
1167029507 19:46948079-46948101 GTATAGGGTGGGACCCTCGCAGG + Intronic
1168171816 19:54594657-54594679 GCTTGGGGAGGGTCCCTGGAAGG - Exonic
1168173732 19:54608086-54608108 GTTTGGGGAGGGTCCCTGGAAGG - Intronic
1168526137 19:57090196-57090218 CTGTAGGGAGGGCCCCTGGCTGG + Intergenic
926566311 2:14478675-14478697 GCATATGGAGAGCCCCTGAAAGG + Intergenic
931263566 2:60640635-60640657 ATAGAGGGTGGGGCCCTGGAGGG - Intergenic
934784499 2:96995195-96995217 GCAAGGGGAAGGCCCCTGGAAGG + Intronic
938462764 2:131508840-131508862 GCACAGGGAGGGCCCCGGAAAGG - Intergenic
938995563 2:136674138-136674160 GTAGATGGAGTGCTCCTGGAGGG + Intergenic
939779887 2:146433012-146433034 GCATAGGGATGGCAGCTGGATGG + Intergenic
940258562 2:151757807-151757829 GTTTAAGCAGGGCCACTGGAGGG - Intergenic
941220703 2:162776681-162776703 GTACAGTCAGGTCCCCTGGAAGG - Intronic
942505730 2:176639231-176639253 GCATTGGGAGGGACCCAGGAGGG + Intergenic
942637540 2:178024036-178024058 GTAGGGGGAGGGGCCCTGGAGGG + Intronic
945234562 2:207622675-207622697 GTATGGTGAGGGCCCCTGTGGGG - Intronic
946646861 2:221846708-221846730 GGATGTGGAGGGCCCTTGGAAGG - Intergenic
947604057 2:231472461-231472483 TTACAGGGAGGACCCCAGGAAGG - Intronic
948461931 2:238134017-238134039 GTCTAGGGAGAGCCCTTGGCTGG + Intergenic
948571672 2:238921726-238921748 GTATTAGAGGGGCCCCTGGAAGG + Intergenic
1172010450 20:31843146-31843168 GGCAAGGGAGGGCCTCTGGAGGG + Intergenic
1173595662 20:44257360-44257382 GTATGGAGTGGGCCCCTGGGTGG - Intronic
1174521231 20:51132312-51132334 TAACAGGCAGGGCCCCTGGAAGG + Intergenic
1175932454 20:62499030-62499052 GTATTGGGATGGCCGCTGGAGGG + Intergenic
1176070119 20:63221953-63221975 GTGCAGGGAGGGGCGCTGGAAGG - Intergenic
1179880623 21:44291983-44292005 GTTTAGGGAGGCCCCCGGCAGGG + Intronic
1183354129 22:37349452-37349474 GTGTGGGCAGGGCCCCTGGGGGG - Intergenic
950653804 3:14424314-14424336 GGATGGGGAGGGCCTCTTGAAGG + Intronic
950711157 3:14813794-14813816 GTATTGGGAGGAGCACTGGATGG - Intergenic
952449249 3:33415883-33415905 GTACCTGGAGGGCACCTGGAAGG - Intronic
953886243 3:46715795-46715817 GAAAAGGGAGCACCCCTGGATGG - Intronic
956058377 3:65324769-65324791 GAGTAGGGAGGGCTCCTGGCAGG - Intergenic
957064027 3:75506525-75506547 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
958653426 3:96969431-96969453 GTATAGGGATGGTTCTTGGAAGG - Intronic
959585935 3:108025418-108025440 GAAAAGGCAGGGCTCCTGGATGG + Intergenic
961061384 3:123831950-123831972 GTCTAGGGAGAGGCCCTGGCAGG + Intronic
961441043 3:126953377-126953399 GTAGAGGGAGGGACCCTTTAAGG + Intronic
962904121 3:139786651-139786673 GTTTAGGAAGGGCTCCTGGGAGG + Intergenic
963302863 3:143618321-143618343 GTATAGAGAGGGTCTTTGGAAGG + Intronic
969634131 4:8356247-8356269 GTCTAGGGCAGGCTCCTGGATGG - Intergenic
969745682 4:9069315-9069337 GTCAAGGGAGGGCCCCTGTCAGG - Intergenic
971114535 4:23629535-23629557 GTTGAGGGAGGGCCCCTGGTGGG + Intergenic
974116689 4:57587660-57587682 TTATAGGGAAGGCCATTGGAAGG + Intergenic
976342905 4:83964735-83964757 GTACAGGCAGGGCACCTGGAAGG - Intergenic
984099893 4:175472646-175472668 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
994724111 5:103414593-103414615 GATTAGGGAGGGGCACTGGAAGG - Intergenic
998398734 5:141836372-141836394 GGCTGGGGAGGGCCTCTGGAGGG + Intergenic
1002325076 5:178399299-178399321 TCAAAGGGAGGGCCCCTGGGAGG + Intronic
1007169782 6:39854387-39854409 ATATCGTGAGGGCTCCTGGAGGG - Intronic
1007183243 6:39945895-39945917 GTATAAGGTGGGGCCATGGAAGG + Intergenic
1007791702 6:44312898-44312920 GTATAGGGAGGGCTTGGGGAGGG - Intronic
1012477062 6:99625130-99625152 ATAAAGGGAGGGACTCTGGAAGG + Intergenic
1015549223 6:134394730-134394752 GCATAGAGAGGGCCACTGGAGGG - Intergenic
1016008193 6:139110872-139110894 GTATAGGGAGGGCCTGTGGTGGG - Intergenic
1016373735 6:143399463-143399485 GTATAGGGGTGGACACTGGAGGG + Intergenic
1019275104 7:172119-172141 GACAGGGGAGGGCCCCTGGAGGG + Intergenic
1019620354 7:1988760-1988782 GCACACGCAGGGCCCCTGGAAGG - Intronic
1020328456 7:6994866-6994888 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
1024042972 7:45569103-45569125 GTCTGGGGAGGGCCACTGGGTGG - Intergenic
1024329205 7:48139674-48139696 GGAGAGAGAGGGCCCCTGCATGG + Intergenic
1029375483 7:100174646-100174668 GTATGGGCAGGGCCCAGGGAGGG - Intronic
1030362644 7:108610959-108610981 GTACAGGAAGGCCACCTGGATGG + Intergenic
1030551311 7:110963941-110963963 GTAGAGGGAGGGGACCTGGTGGG + Intronic
1036249277 8:7147795-7147817 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
1036368170 8:8139246-8139268 GTCAAGGGAGGGCCCCTGTCAGG - Intergenic
1036882715 8:12526401-12526423 GTCAAGGGAGGGCCCCTGTCAGG + Intergenic
1043874798 8:85473695-85473717 CTCAAGGGAGGACCCCTGGATGG + Exonic
1046943837 8:119956533-119956555 GAATGGGGAGGGCCAGTGGATGG - Intronic
1049395303 8:142397449-142397471 GGAAAGGCAGGGCTCCTGGAGGG + Intronic
1049584347 8:143425984-143426006 GGAGCTGGAGGGCCCCTGGAAGG - Intronic
1053311495 9:37023657-37023679 GTATTGGGAGGGCCTGTGGTGGG - Intronic
1056569670 9:87804206-87804228 GTGTAGTGAGAGCCCATGGATGG + Intergenic
1056741617 9:89261227-89261249 GCATAGCCAGGACCCCTGGAGGG - Intergenic
1057798576 9:98175366-98175388 GTGAAGGAAGGGCCCCTTGAGGG + Intronic
1058781935 9:108346401-108346423 GTATAGGGAAGGCTCATAGAAGG + Intergenic
1059426139 9:114222159-114222181 ATGGAGGGAGGGGCCCTGGAGGG + Intronic
1060516814 9:124271096-124271118 GAAGAGGGAGAGCCCCTGGCTGG - Intronic
1190313978 X:49137724-49137746 GTTCAGGAAGGGCCCCAGGATGG - Intergenic
1197728521 X:129792236-129792258 TTCTAGGCAGGTCCCCTGGAAGG + Intronic
1199207449 X:145165336-145165358 TTCAAGGGAGGGCCCCAGGATGG + Intergenic
1200102568 X:153695282-153695304 GGAAAGGCAGGCCCCCTGGAGGG - Exonic
1200305660 X:155023758-155023780 GGAGAGTGAGGGCCCCTGCAGGG + Intronic