ID: 1104912289

View in Genome Browser
Species Human (GRCh38)
Location 12:132245065-132245087
Sequence TTCACCTTCATCCCCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104912289_1104912291 1 Left 1104912289 12:132245065-132245087 CCTTGTCAGGGGATGAAGGTGAA 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1104912291 12:132245089-132245111 GACAGAACCCGCGGTGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 45
1104912289_1104912298 27 Left 1104912289 12:132245065-132245087 CCTTGTCAGGGGATGAAGGTGAA 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1104912298 12:132245115-132245137 CCCTGCCCCGCGGAGGAGTCAGG 0: 1
1: 0
2: 15
3: 21
4: 179
1104912289_1104912294 17 Left 1104912289 12:132245065-132245087 CCTTGTCAGGGGATGAAGGTGAA 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1104912294 12:132245105-132245127 ACACAGGCTCCCCTGCCCCGCGG 0: 1
1: 0
2: 4
3: 24
4: 324
1104912289_1104912295 20 Left 1104912289 12:132245065-132245087 CCTTGTCAGGGGATGAAGGTGAA 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG 0: 1
1: 0
2: 1
3: 28
4: 228
1104912289_1104912290 -8 Left 1104912289 12:132245065-132245087 CCTTGTCAGGGGATGAAGGTGAA 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1104912290 12:132245080-132245102 AAGGTGAAAGACAGAACCCGCGG 0: 1
1: 0
2: 1
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104912289 Original CRISPR TTCACCTTCATCCCCTGACA AGG (reversed) Intronic