ID: 1104912295

View in Genome Browser
Species Human (GRCh38)
Location 12:132245108-132245130
Sequence CAGGCTCCCCTGCCCCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104912289_1104912295 20 Left 1104912289 12:132245065-132245087 CCTTGTCAGGGGATGAAGGTGAA 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG 0: 1
1: 0
2: 1
3: 28
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104912295 Original CRISPR CAGGCTCCCCTGCCCCGCGG AGG Intronic