ID: 1104914753

View in Genome Browser
Species Human (GRCh38)
Location 12:132258847-132258869
Sequence GTCCACGCTGGAGACCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104914740_1104914753 30 Left 1104914740 12:132258794-132258816 CCCTTGGAGACGCCATGGTCTAC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 116
1104914741_1104914753 29 Left 1104914741 12:132258795-132258817 CCTTGGAGACGCCATGGTCTACC 0: 1
1: 0
2: 0
3: 2
4: 60
Right 1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 116
1104914747_1104914753 -8 Left 1104914747 12:132258832-132258854 CCGCAGAGGCCCGCCGTCCACGC 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 116
1104914743_1104914753 18 Left 1104914743 12:132258806-132258828 CCATGGTCTACCGCAAGGTGAGA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 116
1104914745_1104914753 8 Left 1104914745 12:132258816-132258838 CCGCAAGGTGAGATGGCCGCAGA 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104914753 Original CRISPR GTCCACGCTGGAGACCCACA GGG Intronic
900483046 1:2908659-2908681 GTCCAGGCAGGAGACACCCAGGG - Intergenic
900486605 1:2925560-2925582 GTGCACCCTGGAATCCCACAGGG + Intergenic
900594506 1:3474609-3474631 GACCACCCTGCAGCCCCACACGG + Intronic
900652720 1:3738242-3738264 GTCCTCACTGGAGACTCAGAAGG - Intergenic
901238904 1:7681632-7681654 GTTTACCCTGGAGACCCACTGGG + Intronic
901835114 1:11919161-11919183 GTCCACTCTGGGGACCAAAAAGG - Intergenic
902387211 1:16082797-16082819 GTCTAGGCTGGAGAGCCAGAGGG + Intergenic
906380187 1:45327612-45327634 GTCCACGCGGCTGACCCACCCGG - Exonic
908421831 1:63966299-63966321 ATCCACGCGGGAGACCCAGGAGG - Intronic
910462183 1:87459416-87459438 ATGCACGCAGGAAACCCACATGG + Intergenic
913209468 1:116570922-116570944 GACCACGCTGAGGACCCCCAGGG + Exonic
917512997 1:175683593-175683615 GCCCAGGCTGGACATCCACAGGG + Intronic
1067180887 10:43985236-43985258 GTCCAGGCTGGAGAGCCATGTGG - Intergenic
1067429136 10:46231355-46231377 CTCCACCCTGGCCACCCACAGGG - Intergenic
1070526171 10:77297860-77297882 TTCCAAGATGGAGACCCAAAGGG + Intronic
1079383473 11:19958902-19958924 GTCCACGCAGCAGAGCCACAGGG + Intronic
1084534715 11:69749911-69749933 GTCCTCTCTGGGGACTCACACGG - Intergenic
1088456296 11:110036184-110036206 TTCCATGCGGGAAACCCACATGG + Intergenic
1088795562 11:113264458-113264480 CTCCCCGCTGGAGTCCCAGATGG + Intronic
1092454390 12:8629640-8629662 GTACACCCTGGAGACTCCCAGGG - Intergenic
1096732383 12:53625206-53625228 GTCCAAGTTGGAGCCCCATAGGG - Intronic
1098296020 12:69004941-69004963 ATCCAAGCTGGAGAGGCACAGGG + Intergenic
1099470307 12:83040280-83040302 GTCACCACTGGAGACCCACAAGG - Intronic
1100149792 12:91723021-91723043 TTCCAGGCTGGAGAACCACTAGG - Intergenic
1104914753 12:132258847-132258869 GTCCACGCTGGAGACCCACAGGG + Intronic
1104947715 12:132424030-132424052 GACCCAGCTGCAGACCCACAAGG + Intergenic
1105025660 12:132847058-132847080 CTCCCCGCTGGAGAGCCACGAGG + Exonic
1105431718 13:20343193-20343215 GGCCAGGATGGAGGCCCACAGGG - Intergenic
1109252124 13:60032133-60032155 GTGCACGCTGCAAAGCCACAGGG - Intronic
1112594668 13:100796905-100796927 GTCTACACTGCAGAACCACAGGG + Intergenic
1113456801 13:110455145-110455167 GTCCACACGGCAGACTCACATGG + Intronic
1113578935 13:111414426-111414448 ATCCAGTCTGAAGACCCACAAGG + Intergenic
1113768162 13:112893846-112893868 GTCCACTCTGAAGCCCCACAGGG - Intergenic
1114653390 14:24300746-24300768 GTCTACTGTGGAGACACACATGG + Exonic
1121277794 14:92679501-92679523 GCCCTCGCTGGAGAGCCCCAAGG - Intronic
1124237447 15:28002681-28002703 GGCCACGCGGGAGCCTCACAGGG + Intronic
1126068261 15:44843037-44843059 GAACAAGCTGGAGACCAACATGG + Intergenic
1126090572 15:45047767-45047789 GAACAAGCTGGAGACCAACACGG - Intronic
1129257212 15:74340425-74340447 CTCCAGGCTGGAGTCCCAAACGG - Intronic
1132546964 16:537673-537695 GGCCACGCAGGAGTCCCTCACGG - Intronic
1132789268 16:1676217-1676239 GTCTACGCTGGAGAACCAAGTGG - Exonic
1132893132 16:2214352-2214374 GCCCACGCTGGCGACGCCCACGG + Exonic
1134657036 16:15954904-15954926 GTCAAAGCTGGAGACTGACATGG - Intronic
1141428619 16:83959371-83959393 GTCCAGGATGGAGACCCCCGGGG - Exonic
1142190224 16:88714028-88714050 TTCCACGCTGCTGGCCCACATGG - Intronic
1143353303 17:6305874-6305896 GCCCACGCTCCAGACCCACTGGG + Intergenic
1143619560 17:8073225-8073247 GACCACTCTGGAGACCTTCATGG - Exonic
1147494565 17:40903659-40903681 GTCCAAGCTGGAAAAGCACAGGG + Intergenic
1154166035 18:12015197-12015219 GTCCACGCCAGAGACACACAAGG - Intronic
1154235310 18:12600019-12600041 GGCCACGTTGGGAACCCACATGG + Intronic
1160198283 18:76775275-76775297 GTCCTCGCTTGGCACCCACAGGG + Intergenic
1161298496 19:3531785-3531807 GTCCATGTTGGAGGGCCACACGG + Exonic
1161454401 19:4362902-4362924 GTCCAGGCTGGAGGCCCTCTGGG - Intronic
1162321631 19:9974050-9974072 GTCAATGCTGGTGACCCTCAGGG + Intronic
1163366131 19:16877034-16877056 GACCACCCTGGGGACACACACGG - Intronic
1165202622 19:34157658-34157680 GACCACACTGGAGGCCCAGATGG + Intergenic
1165257520 19:34588733-34588755 GCCCATGCAGGAGACACACAGGG + Intergenic
1165264666 19:34650043-34650065 GCCCATGCTGGAGACACATAGGG - Intronic
1167665549 19:50821171-50821193 CTCCACTCTGGAGAGACACAGGG - Intronic
927754719 2:25699475-25699497 ATCCAGGCTGGAGACCCACACGG + Intergenic
931825859 2:66000345-66000367 GTCCATCCTGGAGACCTTCATGG - Intergenic
936034291 2:109098275-109098297 GTCCACGCTGAAAATCAACATGG + Intergenic
936377525 2:111954730-111954752 GTCCATTCTGTAGACCCAAAGGG + Intronic
941296623 2:163746974-163746996 ATACAAGCTGAAGACCCACATGG - Intergenic
942381854 2:175399857-175399879 GTCCCCGCTTTAGAGCCACAGGG - Intergenic
948571422 2:238920157-238920179 GTCAGTCCTGGAGACCCACAGGG - Intergenic
948726709 2:239938663-239938685 GTCCACCCTGCAGCCCCCCAGGG - Intronic
1171374935 20:24685914-24685936 GGACACTCTGGAAACCCACACGG - Intergenic
1173027144 20:39318954-39318976 GTCCAGTCTGCTGACCCACAAGG - Intergenic
1175941862 20:62541088-62541110 GTGCAGGGTGGAGACCCAGAAGG + Intergenic
1176173050 20:63704867-63704889 GCCCACACTGGGGACCCACCAGG + Intronic
1177715290 21:24832536-24832558 TAGCAGGCTGGAGACCCACAAGG - Intergenic
1178943268 21:36925363-36925385 GGCCACGATGAACACCCACAAGG + Intronic
1181557961 22:23683018-23683040 GGCCAGGCTGCCGACCCACAGGG + Intergenic
1182705185 22:32272551-32272573 GTCCACGCTGTACACCTCCAGGG - Intergenic
1182706282 22:32282602-32282624 GTCCAGGCTGGAGGCGTACATGG - Intergenic
1184128874 22:42505408-42505430 GCCCAGGCTGGAGTCCCAGAGGG - Intergenic
1184137669 22:42558723-42558745 GCCCAGGCTGGAGTCCCAGAGGG - Intronic
1184394600 22:44225671-44225693 GTCCAGGCTGGAGGCGTACATGG - Intergenic
1184411925 22:44330964-44330986 GGCCACGCTGCGGACCCAGAGGG - Intergenic
1184464262 22:44659638-44659660 GTCCAAGCTGTCCACCCACAGGG - Intergenic
955332580 3:58059885-58059907 TTTCACCCTGGAGACCCAAACGG - Intronic
961575758 3:127834934-127834956 GCCGAGGCTGGAGACACACAGGG + Intergenic
968127018 3:196167572-196167594 GACCAGCCTGGAGACCAACATGG - Intergenic
968481714 4:835969-835991 CTCCGCGCTGGACACCGACACGG - Intergenic
968503981 4:963607-963629 GTCCAGGCTGGAAATCCACGTGG + Intronic
968693542 4:2008932-2008954 GTCCATGCGGGAGAGCGACACGG - Exonic
968901941 4:3436092-3436114 ATCCTGGCTGGGGACCCACACGG + Intronic
968983064 4:3861120-3861142 GTCCACGCTGGAGACCCTGCCGG + Intergenic
969443270 4:7229494-7229516 GTCCACGCTGGAGAGCACCCAGG + Intronic
969640346 4:8394649-8394671 GTCCTCGCTGGAGCTCCACCAGG + Exonic
973912120 4:55592046-55592068 GGCCCAGCTGGAGACCCACTGGG + Intronic
981220501 4:142227221-142227243 GTCTACTCTGGAGACACAGAAGG + Intronic
985691947 5:1318374-1318396 GGCCACGCGGGCGCCCCACACGG - Exonic
985911570 5:2887812-2887834 GCTCATGCTGGAAACCCACATGG - Intergenic
989113482 5:37929633-37929655 GTGCCTGATGGAGACCCACAAGG + Intergenic
1002261167 5:177994999-177995021 GTGCACACAGCAGACCCACAGGG - Intronic
1002879366 6:1237955-1237977 GTCCAGGCTGGGAACTCACAGGG - Intergenic
1003491977 6:6630714-6630736 GACCAAGATGGAGACCCACTGGG - Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1013304960 6:108839213-108839235 CTCCTGGCGGGAGACCCACAGGG + Intergenic
1019193139 6:170265767-170265789 GTTCACGCTGGCGTCACACAGGG + Intergenic
1019471950 7:1225658-1225680 GTCCAGGCTGGATCCCCACCAGG + Intergenic
1019577188 7:1743257-1743279 GTCCTGCCTGGAGACCCTCAGGG + Intronic
1019653373 7:2172797-2172819 GTCAAGGCTGGAGCCCCAGATGG + Intronic
1025849795 7:65236587-65236609 TTCCTGGCTGGAGAACCACAAGG - Intergenic
1038331868 8:26615426-26615448 GTCCTCCCTGCAGACTCACAGGG - Intronic
1040375876 8:46824122-46824144 AACCAGGCTGGAGACCCACCTGG - Intergenic
1040634148 8:49252997-49253019 GTGCAGGAAGGAGACCCACATGG + Intergenic
1041106077 8:54445175-54445197 ATCCATGCTGGTGACCTACAAGG - Intergenic
1041118178 8:54560814-54560836 ATCCAAGCAGGAGACCCACATGG + Intergenic
1042935278 8:74052205-74052227 GTGCATGCGGGAGGCCCACAGGG + Intergenic
1047940988 8:129827096-129827118 GTCCAGGATGGAGCCCCAGAAGG - Intergenic
1049204600 8:141357898-141357920 GGCCCCGCTGGAGACACAGAGGG + Exonic
1049225159 8:141447091-141447113 GTCCTCGCAGGAAACCCACTGGG + Intergenic
1049283141 8:141760724-141760746 GTCCTCGCTGCAGACCCTCGCGG + Intergenic
1049382303 8:142323392-142323414 GTCCACTCTGGAGACCCAGGAGG - Intronic
1049773473 8:144394268-144394290 GTCCACGCTGTACACCTCCAGGG + Exonic
1050135786 9:2462170-2462192 GTCCCCTCTGGAGACCGAGATGG + Intergenic
1055433625 9:76270432-76270454 GGCCAGGCTGGAGAGCCAAAGGG - Intronic
1057209300 9:93191015-93191037 GCCTGCGCTGGAGACCCCCACGG + Intronic
1059268336 9:113056668-113056690 GACGCCGCTGGAGACCGACATGG + Exonic
1060869692 9:127029718-127029740 GTCCTCTCTGAAGACCCCCACGG - Intronic
1061419711 9:130466609-130466631 GGACATGCTGGAGACCCCCATGG + Intronic
1187585931 X:20661939-20661961 GTACACCCTGGGGAACCACAGGG - Intergenic