ID: 1104915031

View in Genome Browser
Species Human (GRCh38)
Location 12:132260167-132260189
Sequence ATGGAGAAACAGACACAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 1, 2: 13, 3: 121, 4: 887}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104915021_1104915031 16 Left 1104915021 12:132260128-132260150 CCCCAACTCTAATGACAAGGGTC 0: 1
1: 0
2: 1
3: 21
4: 223
Right 1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG 0: 1
1: 1
2: 13
3: 121
4: 887
1104915022_1104915031 15 Left 1104915022 12:132260129-132260151 CCCAACTCTAATGACAAGGGTCC 0: 1
1: 0
2: 8
3: 124
4: 405
Right 1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG 0: 1
1: 1
2: 13
3: 121
4: 887
1104915023_1104915031 14 Left 1104915023 12:132260130-132260152 CCAACTCTAATGACAAGGGTCCT 0: 1
1: 0
2: 12
3: 174
4: 628
Right 1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG 0: 1
1: 1
2: 13
3: 121
4: 887
1104915018_1104915031 25 Left 1104915018 12:132260119-132260141 CCTGGACTGCCCCAACTCTAATG 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG 0: 1
1: 1
2: 13
3: 121
4: 887
1104915028_1104915031 -6 Left 1104915028 12:132260150-132260172 CCTTGCATAAGGCAGGGATGGAG 0: 1
1: 1
2: 1
3: 20
4: 221
Right 1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG 0: 1
1: 1
2: 13
3: 121
4: 887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104915031 Original CRISPR ATGGAGAAACAGACACAGGG AGG Intronic
900417616 1:2542377-2542399 CTCCACAAACAGACACAGGGTGG + Intergenic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900695596 1:4007844-4007866 AGGGAGAGACAGAAATAGGGAGG + Intergenic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
901501806 1:9657143-9657165 ACGGAGACCCAGACACACGGAGG - Intronic
902104912 1:14026886-14026908 ATGGAGGAACAGCCAGATGGGGG + Intergenic
902212833 1:14915989-14916011 ATGAGGAAACAGACACAGAGAGG - Intronic
902249838 1:15147064-15147086 ATGGGGAAACTGAAACAGAGAGG - Intergenic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902405179 1:16178918-16178940 TTGAAGAAACAGGCTCAGGGAGG - Intergenic
902538852 1:17138254-17138276 CTGGAGTAAGAGACACATGGTGG - Intergenic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902561809 1:17282287-17282309 ATGTAGACACAGAAACAGAGAGG - Intronic
902733511 1:18384913-18384935 ATAGAGAGACAGAGACAGAGGGG + Intergenic
902767088 1:18624343-18624365 AGGAAGAAATAGACTCAGGGAGG - Intergenic
903168326 1:21536767-21536789 AAGGGGAAACAGACTCTGGGTGG + Intronic
903288362 1:22291237-22291259 ATGGAGAGACAGGAACAGAGAGG - Intergenic
903500549 1:23797980-23798002 ATGGGGAAACTGAGACTGGGAGG + Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903807616 1:26016774-26016796 ATGCAGCAAGAGAAACAGGGAGG + Intergenic
903935005 1:26889630-26889652 ATGGAGTAACTGAGACAGGGAGG - Intronic
904026429 1:27506563-27506585 ATGAAGAAACAGACAATGAGAGG + Intergenic
904625108 1:31798115-31798137 AGGGAGAGACAGAGACAGGGAGG - Intronic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
904787240 1:32992165-32992187 ATGGTGAAACTGAGGCAGGGGGG - Intergenic
904811599 1:33166575-33166597 ATGGAGAAAAAGATACAGAGAGG + Intronic
904914759 1:33961738-33961760 AGGGAGAAAGAGAGAAAGGGAGG - Intronic
905003322 1:34690623-34690645 ATGACGAAACAGGCACAGAGTGG - Intergenic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905253058 1:36662107-36662129 ATGGACAAACAGAGGCTGGGAGG - Intergenic
905359772 1:37411248-37411270 GTGGTGAATCAGCCACAGGGAGG + Intergenic
905431989 1:37931359-37931381 ATGGAGCAACAGGCCCAGAGAGG + Intronic
905442543 1:38004676-38004698 ATGCAGAGACAGAGAAAGGGAGG - Intronic
905486364 1:38299758-38299780 ATGGAGAAATGGAGGCAGGGAGG + Intergenic
905546338 1:38803197-38803219 ATGGAAAAACAGGCACAGAGAGG - Intergenic
905732329 1:40305562-40305584 ATAGGGAAACAGGCCCAGGGAGG + Intronic
906076550 1:43056249-43056271 AGGGAGAAAGAAACAGAGGGGGG - Intergenic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906750564 1:48255345-48255367 ATGAAGAAACAAACTCAGAGAGG + Intergenic
906835252 1:49076414-49076436 ATGCAGAACCAGAGACAGGGAGG + Intronic
906938669 1:50236680-50236702 ATGGATAACCAGCCACAGAGAGG - Intergenic
907403844 1:54241735-54241757 AGGGAGCCACAGACACAGGGAGG + Intronic
907603041 1:55789057-55789079 CTGGGGAAATAAACACAGGGTGG + Intergenic
907645079 1:56234329-56234351 ATGGAGACGAAGACACAGGCTGG - Intergenic
907835379 1:58103789-58103811 AAGGAAGAACAGAGACAGGGTGG - Intronic
907866689 1:58405796-58405818 ATGAGGAAACAGACACTTGGAGG + Intronic
908449474 1:64238031-64238053 ATGGTCAAACAGACATAGAGAGG - Intronic
908579678 1:65501428-65501450 GAAGAGAAACAGACACAAGGAGG + Intronic
909662416 1:78098791-78098813 ATTTAGACACAGACACAGGGAGG + Intronic
909867734 1:80695216-80695238 ATGGACACAGGGACACAGGGAGG - Intergenic
910378121 1:86595440-86595462 ATGGGGTAACAGGCAGAGGGTGG - Intergenic
910415795 1:86996665-86996687 ATGGAGAAACAGACAACTGAAGG + Intronic
910452050 1:87357389-87357411 ATAGAGAAACAGGCCCAGAGAGG - Intergenic
910649488 1:89550292-89550314 AAGGAGAAATACACATAGGGAGG - Intronic
911054685 1:93699858-93699880 ATGAGGAAACAGACCCAGAGAGG + Intronic
911335599 1:96576461-96576483 ATGTAGAAACAGGTATAGGGAGG + Intergenic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912465170 1:109867653-109867675 AGGGGGAAACAGACACAAAGGGG + Intergenic
912597897 1:110897643-110897665 ATGAAGAAACAGGCATAAGGTGG - Intronic
912699343 1:111864969-111864991 AACAGGAAACAGACACAGGGTGG + Intronic
913074900 1:115333756-115333778 ATGAAGAAAGAGAGAGAGGGGGG - Intronic
913147501 1:116006782-116006804 AAAGAGAAACAGAAACAGAGAGG - Intronic
913494623 1:119417095-119417117 ATGAGGAGACAGACACAGAGAGG + Intronic
914217899 1:145650175-145650197 GTGAACACACAGACACAGGGAGG - Intronic
914442956 1:147723061-147723083 ATGGAGAAATGGAAACAGAGAGG - Intergenic
914447147 1:147759727-147759749 ATGAAGAAACAGACTCAGTGAGG - Intronic
914470453 1:147972850-147972872 GTGAACACACAGACACAGGGAGG - Intronic
914718903 1:150273077-150273099 ATGGAGCTCCAGACACAAGGAGG + Intronic
915448525 1:155988986-155989008 TTGGAGAAAGAGACAGAGGCAGG + Intronic
916044515 1:160989380-160989402 TTGCAGAAACAAACACAGGAAGG - Intergenic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918158284 1:181872335-181872357 ATGGGGAAAATGATACAGGGAGG + Intergenic
918202647 1:182281592-182281614 CTGGAGAATCCAACACAGGGAGG + Intergenic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918975962 1:191486771-191486793 ATGGAGAAACAGACAGGTGGTGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919474319 1:198016184-198016206 GAGGACACACAGACACAGGGAGG - Intergenic
919700751 1:200628818-200628840 GTGGGGAAAGAGACACAGGCAGG + Intronic
919791074 1:201291395-201291417 GTGGACACACAGACACATGGAGG - Intronic
919932316 1:202229355-202229377 ATGGGGAGAGAGACACAGAGAGG - Intronic
920124840 1:203685737-203685759 AAGAAGAAACAGACTCAGGGAGG - Intronic
920540414 1:206773892-206773914 GATGAAAAACAGACACAGGGAGG - Intergenic
920697374 1:208191627-208191649 ATGAAGAAACAGGCACAGAGAGG + Intronic
920771694 1:208892593-208892615 AAGGATAAACACACACAGGGTGG + Intergenic
920818512 1:209358098-209358120 AAGAACACACAGACACAGGGAGG + Intergenic
921080057 1:211732074-211732096 ATGGGGAAAGAGACAGAGGGAGG - Intergenic
921260191 1:213379367-213379389 TTGGAGACAGATACACAGGGAGG + Intergenic
921480727 1:215661887-215661909 ATGGCAAAACAGACCCAGGGAGG - Intronic
922499543 1:226086359-226086381 ATGGAGAGACAGCCAGATGGAGG - Intergenic
923366497 1:233266945-233266967 CTGAAGAAACAGACAGAGGTGGG - Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924757038 1:246950792-246950814 ATGAAGAAACCGAGACAGAGTGG - Intronic
1063011017 10:2021515-2021537 CTGGAGAAGCACACAGAGGGAGG - Intergenic
1063271039 10:4509995-4510017 AGGGAGAGACAGAGACAGAGAGG + Intergenic
1063719973 10:8570200-8570222 ATTGAGAATGAGACCCAGGGTGG - Intergenic
1064891085 10:20174594-20174616 GTGGAAAAAAAGACACAGGAAGG + Intronic
1064950104 10:20839033-20839055 ATGGAGGTACAGACACACTGTGG - Intronic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065199893 10:23302421-23302443 ATGAAGAGGCAGAGACAGGGTGG - Intronic
1065699227 10:28408763-28408785 AGAGAGAAACAGACAAAGAGAGG - Intergenic
1065834318 10:29643067-29643089 CTGGAGAAACAGTCACAAGTTGG + Intronic
1066354083 10:34664996-34665018 AGGGAGAGACAGAGACAGGGAGG + Intronic
1067460206 10:46452584-46452606 ACACAGAAACACACACAGGGAGG - Intergenic
1067626984 10:47932019-47932041 ACACAGAAACACACACAGGGAGG + Intergenic
1068572855 10:58650190-58650212 AGGGAGAAAGAGACAGAGAGAGG - Intronic
1068604048 10:58986029-58986051 ATGGAGAAAGAGGCAAAGAGAGG + Intergenic
1068816037 10:61314162-61314184 ATGGAGAAACTGACATAAAGAGG - Intergenic
1069785552 10:70985814-70985836 AGAGAGAAGCAGACACAAGGTGG - Intergenic
1070219873 10:74430044-74430066 ATGAAGAAACAGAGGCACGGAGG + Intronic
1070376953 10:75841923-75841945 ATGAAGAAACAGAGACAGAGGGG - Intronic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071160800 10:82743101-82743123 AGGGAGAGAAAGGCACAGGGTGG - Intronic
1071879067 10:89874971-89874993 TTGGAGAAATAGCCACAGGATGG + Intergenic
1072630758 10:97144918-97144940 ATGAGGAAATAGACACAGAGAGG + Intronic
1072660675 10:97361645-97361667 GTGGAGAAACAGGAACCGGGAGG + Intronic
1072771250 10:98140564-98140586 AGGGACAGACAGATACAGGGAGG + Intronic
1072885917 10:99273748-99273770 ATAGACAAACAGATGCAGGGAGG + Intergenic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1075103286 10:119520530-119520552 CTAAAGAAACAGACCCAGGGAGG + Intronic
1075444188 10:122502489-122502511 ATGTAGAAACAGATCCAGTGAGG - Intronic
1075551360 10:123395144-123395166 TGGGAGTAACAGAGACAGGGAGG - Intergenic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1075922414 10:126224464-126224486 AGGGAGAAACAAGCACAGGAAGG + Intronic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1076060886 10:127413180-127413202 ATAAAGAAATAGACACAAGGAGG + Intronic
1076077616 10:127548214-127548236 ATGGAGAAAAACACCAAGGGAGG - Intergenic
1076402466 10:130193051-130193073 TTGGAGAAGCAGGGACAGGGTGG - Intergenic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1077146887 11:1050450-1050472 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1077185435 11:1233596-1233618 ATGGGTAAATACACACAGGGGGG - Intronic
1077640388 11:3876291-3876313 ATGGATAAACAGACCTAGGTAGG + Intronic
1077731746 11:4738217-4738239 TTGCAGAAGCAGACACAGGAAGG - Intronic
1079017691 11:16883386-16883408 TTGGAGACAAAGCCACAGGGTGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079379944 11:19929263-19929285 AAAAAGAAACAGACAAAGGGAGG + Intronic
1079401724 11:20111335-20111357 CTGGACAGACAGACACAGAGGGG - Intronic
1079902145 11:26199855-26199877 ATTGAGAAAGAGACAAAGGAAGG - Intergenic
1080008436 11:27433589-27433611 TAGGAGAAACATTCACAGGGAGG - Intronic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080804033 11:35635578-35635600 ATGGGGAAACAGGCACAGAGTGG + Intergenic
1080928660 11:36784798-36784820 AGGGAGAAAGAGACAGAGGGAGG - Intergenic
1081463265 11:43291207-43291229 AAAGAGAATCAGAGACAGGGAGG + Intergenic
1081745321 11:45468768-45468790 ATGAGGAAACAGCCACAGAGAGG + Intergenic
1082668410 11:56004501-56004523 CTGGAGAAATAACCACAGGGTGG + Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083176399 11:60952535-60952557 ATGCAGAGACAGACCCAGTGGGG + Intergenic
1083184523 11:61009427-61009449 AGGGGGACACAGACACAGGAGGG + Intronic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1083434727 11:62634562-62634584 AAGGAGACACAGACCCAGGCAGG + Intronic
1083540665 11:63509755-63509777 CTGGAGAGACAGACAGAGGCTGG - Intronic
1083757529 11:64799686-64799708 AAGGAAAAACAGAAACAGTGTGG + Intronic
1083776424 11:64896314-64896336 ATAGAGAAACAGCCACGGAGAGG - Intronic
1083786617 11:64952563-64952585 ACGGGGAAACAGACAAAGAGAGG + Intronic
1083859492 11:65412258-65412280 CTGAAGACCCAGACACAGGGAGG - Exonic
1084112389 11:67022698-67022720 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1084130563 11:67130884-67130906 ATGGAGAGAGAGGCCCAGGGAGG + Intronic
1084596840 11:70121690-70121712 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596888 11:70122101-70122123 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596920 11:70122375-70122397 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596934 11:70122514-70122536 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084949477 11:72656826-72656848 ATGGGGAAACAGGCCCAGGGTGG - Intronic
1084952556 11:72674691-72674713 ATAGAGAAACACACACACAGAGG + Intergenic
1085025757 11:73235631-73235653 ATGGAGAAACAGGCCCAGAGAGG + Exonic
1085218154 11:74850182-74850204 ATGAAGCAACAGACTCAGAGAGG - Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085416429 11:76321831-76321853 AGGCAGACACAGACCCAGGGTGG - Intergenic
1085440118 11:76553780-76553802 ATGGAGAAACTGACTCGGAGAGG - Intergenic
1085484565 11:76851047-76851069 ATGATGAAACTGACACAGTGAGG - Intergenic
1085567904 11:77531383-77531405 AGGGAACAACAGACACTGGGAGG - Intronic
1085956692 11:81406523-81406545 ATGAAGAGACAAACAGAGGGAGG - Intergenic
1087324020 11:96699115-96699137 GTTGAGAAACACATACAGGGTGG + Intergenic
1087511796 11:99103786-99103808 ATAGAGAAAGAGACACATAGGGG + Intronic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088735686 11:112725904-112725926 ATGGGGACACAGAGACAGAGTGG + Intergenic
1088968463 11:114749864-114749886 GTGGGGAATCAGGCACAGGGTGG - Intergenic
1089001788 11:115058089-115058111 ATGGTGGGACAGGCACAGGGTGG - Intergenic
1089757775 11:120699030-120699052 AGGGGCAAACAGACACAGGTGGG - Intronic
1089974665 11:122722154-122722176 ATGAAGACAGAGGCACAGGGAGG + Intronic
1090480933 11:127067467-127067489 ATGGAGAAAGAGATCCGGGGAGG + Intergenic
1090556129 11:127878492-127878514 ATGAAGAAACACACAGAGTGAGG + Intergenic
1091144040 11:133261715-133261737 GTGGAGAAAGAGAGACGGGGAGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1092119835 12:6036239-6036261 ATGGAGAAACACAGGCACGGAGG + Intronic
1092231519 12:6778209-6778231 ATGGAGAGAGAGACGGAGGGCGG - Intronic
1092248141 12:6874942-6874964 AGGAAGAAACAGGCACAGGGAGG - Intronic
1092752631 12:11733027-11733049 ATGGAGAAACAGAGTCTGAGTGG - Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093267448 12:17020316-17020338 AAGGAGGGAGAGACACAGGGAGG - Intergenic
1093483635 12:19629778-19629800 ATGAAGAAACAATCTCAGGGAGG + Intronic
1094461426 12:30700582-30700604 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1095041164 12:37442444-37442466 AGGGATAGACATACACAGGGAGG - Intergenic
1096021683 12:48330277-48330299 AAGAGGAAACAGACACAAGGTGG - Exonic
1096749958 12:53752192-53752214 AGGCAGAAAGAGACAGAGGGTGG - Intergenic
1096845868 12:54406099-54406121 ATAGTGAAGCAGACATAGGGTGG - Intronic
1097954037 12:65464899-65464921 ATGAAGAAATAGGCACAGAGAGG - Exonic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1098487073 12:71033772-71033794 ATGGAGAAGCAGACAAAGTTGGG + Intergenic
1099374490 12:81882237-81882259 ATGTGAACACAGACACAGGGAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100684911 12:96977161-96977183 ATGGGACAACCGACACAGGGAGG - Intergenic
1101109080 12:101468191-101468213 ATGAAGAAACAGGCTCAGGGAGG - Intergenic
1101314729 12:103618702-103618724 ATGAGGAAACAGGCACAGAGTGG - Intronic
1101823235 12:108200308-108200330 ATGAAGAAACAGGCTCAGAGAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1101853795 12:108425532-108425554 CAGGACAAACAGACTCAGGGAGG + Intergenic
1101865061 12:108514758-108514780 AGGGAGGAAAAGACACAGAGAGG + Intergenic
1101979496 12:109393345-109393367 ATGGATTCACAGACACAAGGAGG - Exonic
1102350120 12:112185627-112185649 ATGGAGAAACAGAGGTTGGGAGG + Intronic
1102512470 12:113425103-113425125 AAGGGGAAACAGGCACAGAGAGG + Intronic
1102517002 12:113456357-113456379 ATGGAGACACAAACACAGTGTGG + Intergenic
1102655840 12:114481629-114481651 ATGCAGAGAGAGACACAGGTGGG + Intergenic
1102731259 12:115112705-115112727 TTGGAGACACAGACACACAGGGG - Intergenic
1103000430 12:117381669-117381691 ATGAAGAAAGAAAAACAGGGAGG - Intronic
1103151283 12:118641206-118641228 ATGGAGGAAGGGACTCAGGGAGG + Intergenic
1103175440 12:118859403-118859425 AGGGAGAAACAAACAAAGGTGGG - Intergenic
1103526858 12:121574947-121574969 AGGGAGAAAGAGACATAGAGAGG - Intronic
1103706959 12:122880403-122880425 ACGGAGACACAGACACAAGCTGG + Intronic
1103916235 12:124377018-124377040 AGGGAAAAAGAGGCACAGGGTGG + Intronic
1104131713 12:125900028-125900050 AAGGAGAAAGAGAGACAGAGAGG - Intergenic
1104332011 12:127855774-127855796 ATGCAGACACAGACACTGTGTGG + Intergenic
1104360919 12:128132482-128132504 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1104769105 12:131349571-131349593 AGGAAGAAACAGAGACAGGTAGG - Intergenic
1104847981 12:131856461-131856483 ACAGAGAGACAGAGACAGGGAGG - Intergenic
1104847986 12:131856523-131856545 AAGGAGAGACAGAGACAGAGAGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1104923408 12:132303064-132303086 AGAGAGAGACAGACAGAGGGTGG - Intronic
1104987950 12:132607690-132607712 AGGGAGAGACAGAGACAGAGAGG - Intronic
1104987963 12:132607860-132607882 AGGGAGAGACAGAGACAGAGAGG - Intronic
1105432636 13:20351145-20351167 ATGAATAAACAAACACAGTGTGG + Intergenic
1105493658 13:20911329-20911351 ATTGAGTAAAGGACACAGGGAGG - Intergenic
1105701573 13:22939004-22939026 GTGGAGAAAAAGGCACAGGTGGG - Intergenic
1105961879 13:25349288-25349310 ATGGAGAAAGATCAACAGGGAGG - Intronic
1106289906 13:28350969-28350991 ATGGAGAAACAGAGAGACGGTGG - Intronic
1106426009 13:29630521-29630543 AAGAACACACAGACACAGGGAGG - Intergenic
1106695329 13:32166684-32166706 TTCGAGGGACAGACACAGGGAGG + Intronic
1107663090 13:42659525-42659547 AAGGAGAAACTGAGACAGAGAGG - Intergenic
1107905372 13:45056636-45056658 AGGGAGAAACAGAAAAAAGGAGG - Intergenic
1108486200 13:50928738-50928760 ATGTGGAAACAGCCACAGGAAGG + Intronic
1108905904 13:55472525-55472547 ATGGAAATTCAGACACAGGAAGG + Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1110324866 13:74202219-74202241 AGGGAGAAAGACACAGAGGGAGG + Intergenic
1110767417 13:79296786-79296808 ATGGAAAAAGAGACACAGAGTGG + Intergenic
1112086628 13:96038992-96039014 ATGGAGAGACAGGCATAGGATGG + Intronic
1112211737 13:97384632-97384654 ATGAAGAAACACAGACTGGGAGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1112870282 13:103962662-103962684 TTTGGGAAACAGACACGGGGAGG - Intergenic
1112924206 13:104653690-104653712 AGAGAGAAACAGACAAAGAGGGG + Intergenic
1113024394 13:105924130-105924152 ATGGAGAAACAGACAGTTGGCGG - Intergenic
1113992752 14:16041358-16041380 ATGGAGAGAGAGAGAAAGGGAGG - Intergenic
1115018741 14:28649252-28649274 ATCGAGAAACAGACAGAATGGGG + Intergenic
1116763111 14:49039065-49039087 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1116770922 14:49126040-49126062 ATGAACAAATGGACACAGGGAGG - Intergenic
1117214066 14:53531841-53531863 ATGGAGAAAAGGACAAAGGGAGG - Intergenic
1117528156 14:56632260-56632282 ATGCAGACACAGTCACAGGAAGG - Intronic
1117642320 14:57813063-57813085 ATGAGGAAACAGGCACAGAGAGG + Intronic
1117662321 14:58020494-58020516 ATAGAGAAAGAGACAAGGGGAGG - Intronic
1118384442 14:65244062-65244084 AGGGAGAGAGAGAGACAGGGAGG + Intergenic
1118833093 14:69453280-69453302 ATGGACAACCAGACCCAGCGTGG - Exonic
1119370730 14:74139548-74139570 TTGGAGAAATAGCCAAAGGGAGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119617250 14:76107090-76107112 ATGGAGTGACAGTGACAGGGAGG - Intergenic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1121340030 14:93099691-93099713 ATGCAGCCACAGCCACAGGGAGG + Intronic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121877410 14:97465998-97466020 AGGGAGAAGAAGACACAGAGTGG - Intergenic
1122799140 14:104221159-104221181 ATGGGAACAGAGACACAGGGTGG - Intergenic
1124625867 15:31307199-31307221 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
1124902277 15:33835485-33835507 AAGGAGAGGCAGAGACAGGGAGG - Intronic
1125344567 15:38705972-38705994 AGCGAGAAAAAGACAAAGGGTGG + Intergenic
1126096757 15:45095655-45095677 ACGGAGACACAGGCAGAGGGAGG + Intronic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1126237240 15:46400451-46400473 ATGGACACAGGGACACAGGGAGG + Intergenic
1126251612 15:46574145-46574167 ATGGAGAAAGGGACGAAGGGAGG + Intergenic
1126293618 15:47111287-47111309 AGGGATAGACATACACAGGGAGG + Intergenic
1126553449 15:49959672-49959694 ATGGAGAGAAAGACACTAGGTGG + Intronic
1126704815 15:51397319-51397341 AGGGAGGAACAGAGAAAGGGAGG - Intronic
1126757822 15:51941433-51941455 CTGGAGAAAGAGACACAGAGGGG + Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1128211694 15:65907989-65908011 TTGTAGAAAGAGATACAGGGTGG + Intronic
1128253404 15:66179639-66179661 TTGGGGAAACTGAGACAGGGAGG - Intronic
1128777398 15:70332424-70332446 AGGGAGAAAGAGACAGAGAGAGG - Intergenic
1128999145 15:72318862-72318884 AAGAAGAAAGGGACACAGGGTGG + Intronic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1130086169 15:80779769-80779791 ATGGACAAACAGACAGATAGAGG - Intronic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130515912 15:84625655-84625677 ATGGAGAGGCAGGCATAGGGAGG - Intronic
1131313105 15:91308485-91308507 ATGGAGCAATAGACAAAGAGGGG - Intergenic
1131460027 15:92611243-92611265 AGGGAGGAAGAGACAAAGGGAGG + Intergenic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132153339 15:99477609-99477631 TTGAAGAAACAGGCTCAGGGAGG + Intergenic
1132867638 16:2101688-2101710 CTGAAGAAACAGCCACGGGGAGG + Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133274286 16:4627259-4627281 AAGGAGAAAGAGTCACTGGGTGG + Intronic
1134238583 16:12487049-12487071 AAGGGGAAACAGGCACAGAGAGG - Intronic
1134316818 16:13126586-13126608 AGAGAGAAAGAGAGACAGGGAGG + Intronic
1134524142 16:14931426-14931448 TTGAAGAAACAGCCACGGGGAGG - Intronic
1134548762 16:15129509-15129531 TTGAAGAAACAGCCACGGGGAGG + Intronic
1134711731 16:16329911-16329933 TTGAAGAAACAGCCACGGGGAGG - Intergenic
1134719584 16:16373210-16373232 TTGAAGAAACAGCCACGGGGAGG - Intergenic
1134878134 16:17720418-17720440 ATGGGAAAACACACTCAGGGAGG + Intergenic
1134947842 16:18338675-18338697 TTGAAGAAACAGCCACGGGGAGG + Intergenic
1134955097 16:18378782-18378804 TTGAAGAAACAGCCACGGGGAGG + Intergenic
1135485184 16:22858717-22858739 ATACAGAAACAGACTCAGAGAGG - Intronic
1135627871 16:24011815-24011837 ATGAAGAAACAGGAACAGAGAGG - Intronic
1135658599 16:24274295-24274317 GTGAGGAAACAGACACAGAGAGG - Intronic
1136060334 16:27721959-27721981 ATAAGGAAACAGACACAGAGAGG + Intronic
1136369360 16:29826268-29826290 ATGAGGAAACAGGCACAGGGTGG + Intronic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137574990 16:49593636-49593658 ATGGAGAAACAAAGGCACGGAGG - Intronic
1137812796 16:51368803-51368825 ATGAAGAAACAGATTCAGAGAGG + Intergenic
1137955087 16:52821234-52821256 ATGGAGGAACACAGAAAGGGCGG + Intergenic
1138206547 16:55129815-55129837 AGAGGAAAACAGACACAGGGAGG + Intergenic
1138335326 16:56248578-56248600 ATGAAGAAAAATAAACAGGGAGG + Intronic
1138498161 16:57421316-57421338 ATGGAGAAATAGGCTCAGGCAGG - Intergenic
1138512051 16:57514581-57514603 ATGAAGAAACTGACACAGAGAGG + Intronic
1138779651 16:59767485-59767507 GAGGACAAATAGACACAGGGAGG - Intergenic
1138858638 16:60727489-60727511 ATGGTGAAACAGAGAGAGAGTGG - Intergenic
1138919282 16:61507428-61507450 ATGGAGGAAGAGATACATGGTGG - Intergenic
1138929207 16:61631833-61631855 AAGGAGAAAGAAACAAAGGGTGG + Intergenic
1139457500 16:67093455-67093477 ATGCAGAAACAGCCACGAGGAGG - Intronic
1139528379 16:67529838-67529860 ATGCAGAAACAGGCCCAGAGAGG + Exonic
1139636935 16:68263852-68263874 ATGGAGGAGCAAACAGAGGGAGG + Intergenic
1139969908 16:70767742-70767764 ATGAGGAAACAGACCCAGAGAGG - Intronic
1140183520 16:72745275-72745297 ATTGAGAAACAGACCCAGTGAGG - Intergenic
1140675425 16:77324199-77324221 ATGGAGAAAGAACCACAGGTAGG + Intronic
1140865791 16:79060950-79060972 ATGGAAAAACAAGCACAGAGAGG + Intronic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141605520 16:85151423-85151445 ATGCAGAGACACACACAGAGCGG - Intergenic
1141768486 16:86074159-86074181 AGGGACCTACAGACACAGGGTGG - Intergenic
1141768625 16:86075039-86075061 ATGGAGAAACAGGCCCAGGGTGG - Intergenic
1141772681 16:86100799-86100821 ATAGGGAAACAGAAAAAGGGTGG + Intergenic
1141821494 16:86449359-86449381 ATGGAAAAACAGAGATACGGAGG + Intergenic
1141883734 16:86877831-86877853 AGAGAGAGACAGAGACAGGGAGG - Intergenic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142326125 16:89415853-89415875 ATGGAGAACCAGCCTCAGTGAGG + Intronic
1143114587 17:4575556-4575578 ACAGAGAAACAGAGACTGGGAGG + Intergenic
1143403666 17:6661672-6661694 CTGAAGAAACAGACACAAGTGGG - Intergenic
1143589256 17:7871257-7871279 ATGAGAAAACAGACAAAGGGAGG - Intronic
1143618892 17:8069881-8069903 ATGAGGAAACAGGCACAGAGAGG - Intergenic
1143747575 17:9004978-9005000 ATGAGGAAACAGACACAGAGGGG - Intergenic
1144054614 17:11528605-11528627 ACTGAGACACAGACACTGGGTGG + Intronic
1144395361 17:14837913-14837935 ATGAAGAAACAGACTAAGTGAGG - Intergenic
1144670528 17:17130311-17130333 AGGGACAAACAGACAAAGGAAGG - Intronic
1144822078 17:18082292-18082314 ATGTAGAAACAGGCTCAGAGAGG + Intergenic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1145259004 17:21343714-21343736 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1145301727 17:21645662-21645684 AGGAGGAAACAGACACAGGCAGG + Intergenic
1145317617 17:21744290-21744312 CTGGGGAAACAGGCACAGAGAGG - Intergenic
1145348583 17:22057662-22057684 AGGAGGAAACAGACACAGGCAGG - Intergenic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1145709442 17:26956949-26956971 AGGGAGACATACACACAGGGAGG + Intergenic
1145889053 17:28402202-28402224 ATGAGGAACCAGACACAGGTGGG + Exonic
1146299336 17:31676140-31676162 AGGGAGAAAAAGAGAGAGGGAGG + Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146504888 17:33396161-33396183 ATAAAGAAACAGACCCAGAGAGG + Intronic
1146645908 17:34577628-34577650 AGGGAGGGACAGAGACAGGGAGG + Intronic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1147133502 17:38422201-38422223 ATGAGGAAACAGACACAGAGAGG - Intergenic
1147135593 17:38432238-38432260 ATTAAGAAACTGACACAGGCCGG + Intronic
1147406339 17:40215082-40215104 ATGAAGAAACAGACACAGCAAGG - Intergenic
1147744113 17:42684623-42684645 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1148049633 17:44763282-44763304 ATGGAGAAACAGGCACAGAGAGG + Intronic
1148197932 17:45728223-45728245 CAGGATAGACAGACACAGGGAGG - Intergenic
1148440763 17:47710637-47710659 ACGGAGAAACAGCCAGTGGGTGG - Exonic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148856327 17:50581004-50581026 AGGGAGACAGAGACACATGGGGG + Intronic
1148856365 17:50581209-50581231 AGGGAGACAGAGACACAGAGAGG + Intronic
1150477807 17:65487918-65487940 AGGGAGAAAGAGAGAGAGGGAGG + Intergenic
1150624301 17:66831843-66831865 ATAGAAAAAGAGACCCAGGGTGG + Intergenic
1150776920 17:68088486-68088508 ATGGGGAAACAGACTCAATGAGG + Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151306429 17:73265574-73265596 ATTGAGACACAGGCACAGAGGGG + Intergenic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1152057556 17:78042387-78042409 ATGAAGAAACAGGCTCAGAGAGG - Intronic
1152387743 17:79985215-79985237 ACGGACACACAGACACAGGAGGG - Intronic
1152418738 17:80180356-80180378 ATGGCGAGGCAGACAGAGGGTGG - Intronic
1152840240 17:82562677-82562699 AAGGAAAAATAGACACTGGGTGG + Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153346589 18:4032824-4032846 ACGGAGAGACAGAGACAGAGAGG - Intronic
1153387583 18:4515552-4515574 ATGCAGACACAGACACACAGGGG + Intergenic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1153751882 18:8240596-8240618 ATGGAGAGAGAGAGAGAGGGAGG + Intronic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1155246475 18:23915088-23915110 ATGAGGAAACAGAGACAGCGAGG + Intronic
1155896682 18:31337880-31337902 AAGGAGGAGCAGAAACAGGGGGG + Intronic
1156470297 18:37373608-37373630 ATTAAGAAACTGGCACAGGGAGG + Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157891007 18:51417959-51417981 ATGGGGAGACAGACACTGGTTGG - Intergenic
1158066940 18:53421945-53421967 ATGTAGAAAAAGAGACAGAGAGG + Intronic
1158234225 18:55295035-55295057 ATGGAGAATCAAAAACAGGTTGG + Intronic
1158435419 18:57432119-57432141 ATAGAGAGACACACACAGAGAGG - Intergenic
1159729926 18:72013435-72013457 ATGAAGAACCAGCCACTGGGGGG - Intergenic
1160138561 18:76296999-76297021 ATGGAGAAATAGACATATGTAGG + Intergenic
1160139789 18:76311239-76311261 CTGGAGAAGCAGACACAGCTCGG - Intergenic
1160180609 18:76632090-76632112 ATGAACACATAGACACAGGGAGG - Intergenic
1160505601 18:79424946-79424968 ACGGAGAGACAGACACAGAGAGG - Intronic
1160697999 19:493933-493955 AGGGAGACAGAGACACAGAGAGG - Intronic
1161242057 19:3228198-3228220 ACAGAGAAACACAGACAGGGAGG + Intronic
1161664483 19:5567026-5567048 ATGGAGAGAGACACACAGAGAGG + Intergenic
1161735444 19:5989624-5989646 AGGAAGAAACAGAAGCAGGGGGG - Intergenic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1163207362 19:15813507-15813529 AGGGAGAAACAGAGAGAGAGAGG + Intergenic
1163247517 19:16106241-16106263 AGGGAGAAACAGACACACAAAGG - Intergenic
1163565788 19:18050557-18050579 AGGGAGAAAGAGACAAAGAGGGG + Intergenic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1163753398 19:19092123-19092145 TAGGAGACACAGACACAGTGGGG - Intronic
1163778314 19:19231228-19231250 ATAGGGAGACAGACACAGAGAGG + Intronic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1165112036 19:33508087-33508109 AAGGAGAAACAGCTTCAGGGAGG - Intronic
1165258637 19:34595364-34595386 AGGGAGAAACAGTGAAAGGGTGG + Exonic
1165314003 19:35043886-35043908 AAAGAGAAACAGACACAAAGTGG + Intronic
1165357354 19:35312243-35312265 ATGCAGTCACAGACACAGGCAGG - Intronic
1165395809 19:35563071-35563093 ATGGAGAAATAGAGAGAGGGAGG - Intronic
1165617425 19:37214251-37214273 TTAGAGAGACAGACAAAGGGAGG - Intronic
1165834391 19:38745388-38745410 ATGGAGAGGAAGAGACAGGGAGG - Intronic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1166133303 19:40759814-40759836 CTTGAGAAACAGTCACAAGGAGG - Intronic
1166152724 19:40885788-40885810 ATGCAGAGACAGACACAGATTGG - Intronic
1166351738 19:42202050-42202072 ATGGGGAAACAGGCTCAGAGAGG - Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1166855226 19:45779938-45779960 AAGGGGAGACAGACAGAGGGTGG - Exonic
1167294801 19:48643756-48643778 ATGCAGAAACTGACACACAGAGG - Intronic
1167552391 19:50170026-50170048 AGGGAGGGACAGACAGAGGGAGG - Intergenic
1167609681 19:50501174-50501196 AGGGAGACACAGAGACAGAGGGG + Intergenic
1167621963 19:50565753-50565775 AGGGAGCCACAGACTCAGGGAGG - Intronic
1167643376 19:50693892-50693914 ATGGGGACAGAGACACAGGATGG + Intronic
1168168350 19:54570537-54570559 CTGGGGATACAGCCACAGGGTGG - Intergenic
1168233359 19:55047030-55047052 ATGAAGAAACAGGCTCAGAGGGG + Intronic
1168265989 19:55224390-55224412 ATGGGGAATCAGACCCACGGTGG + Intergenic
925060687 2:887724-887746 ACGGAGAAACACAGACAGGGTGG + Intergenic
925097834 2:1221300-1221322 AGGGAGAGACAGAGACAGAGAGG - Intronic
925106906 2:1299494-1299516 AAGGAGACAGAGACCCAGGGAGG - Intronic
925134942 2:1520277-1520299 CTGAAGAATAAGACACAGGGAGG - Intronic
925225917 2:2184068-2184090 AGAGAGAAACAGAGAGAGGGAGG + Intronic
925673597 2:6337365-6337387 ATGGAGAAACAAGCAGAAGGTGG + Intergenic
925881915 2:8359871-8359893 CTGGAGAATCAGGCACAGGATGG + Intergenic
926095120 2:10076422-10076444 ATGGAGAATAGGACACAAGGAGG - Intronic
926159952 2:10480896-10480918 AGGGAGAAAGAGAGAGAGGGAGG - Intergenic
926317172 2:11718892-11718914 ATGGAAAAACAAGCAAAGGGTGG + Intronic
926705028 2:15831038-15831060 ATGAAGAGACAGACAGAAGGTGG + Intergenic
927480619 2:23451195-23451217 ATGAGGAGACAGACACAGAGAGG - Intronic
927497580 2:23561167-23561189 ATGGAGAGGCAGAGACAGAGGGG - Intronic
928186148 2:29113135-29113157 ATGAAGAAGCAGACTCTGGGAGG - Intronic
928204153 2:29272115-29272137 AGAGAGAGACAGTCACAGGGAGG + Intronic
928266954 2:29820260-29820282 ATGGAGAAGTCCACACAGGGAGG + Intronic
929046770 2:37798192-37798214 GTGGAGAAACAGGCACAGACAGG - Intergenic
929046844 2:37798645-37798667 ATGGGGAAAAAGGCAGAGGGTGG - Intergenic
929231988 2:39569504-39569526 ATGGTGAAAGGGACAAAGGGAGG - Intergenic
929411560 2:41702642-41702664 ACAGAGAGACACACACAGGGAGG - Intergenic
929429392 2:41874307-41874329 ATGAAGAAACAAACTCAGAGAGG + Intergenic
930414302 2:51070557-51070579 ATGGAGAAACAAGTACAGAGAGG + Intergenic
930552340 2:52851850-52851872 ATGGACAAACTGACACAAGTAGG - Intergenic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931591456 2:63888108-63888130 ATGGAGAAACAAAGCAAGGGTGG + Intronic
931789814 2:65654745-65654767 TTGGAGAATCAGGCACAGGCTGG - Intergenic
931849957 2:66243220-66243242 ATTGAAAAACAGACACAGTATGG - Intergenic
931850900 2:66249588-66249610 ATTGAAAAACAGACACAGTATGG - Intergenic
932605637 2:73163617-73163639 ATGAGGAAACAGACACAGAGAGG + Intergenic
932654473 2:73597679-73597701 ATGGGGAAACTGACACAAAGAGG + Intronic
933234542 2:79850374-79850396 AGGGAGAAACAAACAGAGGGAGG - Intronic
933588975 2:84210668-84210690 ATGAAGAAACAGGCACAGAGAGG - Intergenic
934054331 2:88239459-88239481 GTGAAGACACAGACACAGAGGGG - Intergenic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
934612844 2:95753586-95753608 AAGGAGAGACAGACAGAGAGGGG + Intergenic
934648064 2:96070836-96070858 AAGGAGAGACAGACAGAGAGGGG - Intergenic
934841438 2:97626659-97626681 AAGGAGAGACAGACAGAGAGGGG - Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935744488 2:106178767-106178789 ATGGAGGAGTAGACATAGGGCGG - Intronic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936789245 2:116131272-116131294 ATCGAGAAACAGAGACAGTATGG + Intergenic
936831221 2:116650120-116650142 ATATAGAAACAGAGACACGGAGG + Intergenic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
937874109 2:126807913-126807935 AGGAAGAAACAGACACAAAGCGG + Intergenic
937896019 2:126977198-126977220 CTGGGGAAACACACACGGGGTGG + Intergenic
938155538 2:128936672-128936694 ATGGAGAAACGTACACATAGAGG - Intergenic
938700896 2:133878359-133878381 ATGGAGATACAGAACCAGGCAGG + Intergenic
938979459 2:136512341-136512363 ATGGACAAATAGACACTGGTTGG - Intergenic
940963632 2:159813625-159813647 AGGGAGATACAGACACACAGAGG - Intronic
941624035 2:167810421-167810443 ATGAAAAAACAAACAAAGGGTGG - Intergenic
942385776 2:175441255-175441277 CTGGGGAAACAGCCACAAGGAGG - Intergenic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
942956775 2:181782714-181782736 AAGGAAACAGAGACACAGGGAGG + Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944669235 2:201981457-201981479 ATGAAGAAACAGGCACACTGAGG + Intergenic
944786792 2:203079525-203079547 ATAGAGAAAGAAACAGAGGGAGG - Intronic
945160298 2:206883607-206883629 AGGGGAAAACAGGCACAGGGAGG + Intergenic
945168709 2:206973518-206973540 ATGAAGAAACTGAGACAGAGAGG + Intergenic
945246012 2:207717746-207717768 AAGGACAGAAAGACACAGGGTGG + Intronic
945323967 2:208461439-208461461 ATGGAGAAGCAAACACACAGAGG - Intronic
946135585 2:217644273-217644295 AAGGAGAAAGAGAGACAGAGAGG + Intronic
946166457 2:217867052-217867074 ATGAAGAAACAAGCACAGAGAGG - Intronic
946508367 2:220326137-220326159 AGGAAGAAACAGAGGCAGGGAGG - Intergenic
946640022 2:221773983-221774005 ATGGAGGACCAGAAACAGGTAGG - Intergenic
946666114 2:222051581-222051603 AGAGAGAAACAGACACAGAAAGG + Intergenic
947525690 2:230875451-230875473 ATGGAGAAACTGAGACGGTGGGG - Intronic
948115279 2:235490827-235490849 ATGGGGACACAGACACACAGAGG + Intergenic
948315637 2:237026560-237026582 AAGAAGCAACAGACACCGGGAGG + Intergenic
948795822 2:240401678-240401700 ACAGAGAGACAGACACAGAGGGG - Intergenic
1168826756 20:819327-819349 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1168980663 20:2001045-2001067 ATGAAGAAACAGACACTGAGAGG + Intergenic
1170341932 20:15338668-15338690 ATGAAGAAACAGGCCTAGGGGGG + Intronic
1170501534 20:16979544-16979566 CTGGAGAAACACACATTGGGTGG + Intergenic
1170700084 20:18695651-18695673 AGGAAGAAACAGAAAAAGGGAGG - Intronic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1171518304 20:25757045-25757067 AGGAGGAAACAGACACAGGTAGG + Intergenic
1171535756 20:25887353-25887375 AGGGATAGACATACACAGGGAGG - Intergenic
1171558553 20:26099161-26099183 AGGAGGAAACAGACACAGGCAGG - Intergenic
1171572103 20:26262545-26262567 AGGGATAGACATACACAGGGAGG + Intergenic
1171795665 20:29564323-29564345 CTGGAGGAACACACACAGAGAGG - Intergenic
1171805337 20:29673831-29673853 AGGGATAGACATACACAGGGAGG + Intergenic
1171811962 20:29752367-29752389 AAGGAGAAAGAGACAGAGAGAGG + Intergenic
1171838716 20:30182599-30182621 AGGGATAGACATACACAGGGAGG - Intergenic
1172718646 20:36982831-36982853 ATGGAGACAATGATACAGGGTGG + Intergenic
1172762517 20:37332405-37332427 CTGGAGAAACATCCACTGGGAGG + Intergenic
1173065290 20:39704823-39704845 ATGGAGAAAGAAATACAGGTAGG + Intergenic
1173096050 20:40029574-40029596 ATGGAAGAACAGAGAAAGGGAGG + Intergenic
1173362337 20:42355788-42355810 ATTGATATACAGACACTGGGAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1174053454 20:47783040-47783062 ATGAGGAAACAGGCACAGAGAGG - Intronic
1174057614 20:47809549-47809571 CTGGGGAAACAGGCTCAGGGAGG + Intergenic
1174061240 20:47834413-47834435 ATGGAGCTGCAGACTCAGGGAGG - Intergenic
1174070378 20:47895349-47895371 GTGGAGCTACAGACCCAGGGTGG + Intergenic
1174070536 20:47896286-47896308 ATGGAGCTGCAGACTCAGGGAGG + Intergenic
1174101047 20:48126387-48126409 ATGGAGCTGCAGACCCAGGGAGG - Intergenic
1174103989 20:48149102-48149124 AGGGAGACACAGACACAGAGGGG - Intergenic
1174153634 20:48503079-48503101 ATGGAGGTACAGACCCAGGGAGG - Intergenic
1174153661 20:48503226-48503248 CTGGAGCTACAGACCCAGGGAGG - Intergenic
1174154086 20:48505577-48505599 ATGGAGCTGCAGACCCAGGGAGG - Intergenic
1174154625 20:48508423-48508445 ATGGAGCTGCAGACCCAGGGAGG - Intergenic
1174155206 20:48511556-48511578 ATGGAGCTACATACCCAGGGAGG - Intergenic
1174155577 20:48513518-48513540 ATGGAGCTGCAGACCCAGGGAGG - Intergenic
1174156027 20:48515913-48515935 ATGGAGCTGCAGACCCAGGGAGG - Intergenic
1174156064 20:48516110-48516132 GTGGAGCCACAGACCCAGGGAGG - Intergenic
1174509505 20:51040471-51040493 ACAGAGATACAGACACAGAGCGG - Intergenic
1174511212 20:51054302-51054324 CAGAAGAAACAGACACAGAGAGG + Intergenic
1174514683 20:51082810-51082832 AAGGACAAACAGGCACAGGTGGG + Intergenic
1174519768 20:51120445-51120467 ATGAGGAAACAGGCACAGAGTGG + Intergenic
1174690874 20:52503355-52503377 ATGATGAAACAGACACAGAGAGG + Intergenic
1175151960 20:56941865-56941887 AAGAAGACACAGTCACAGGGAGG + Intergenic
1175515171 20:59565056-59565078 ATGGAGAGACAGACAGACAGAGG + Intergenic
1175740577 20:61417278-61417300 ATGGAGAAAGACAGAGAGGGAGG - Intronic
1175768153 20:61605404-61605426 ATAGAGAAACAGACAAAGAGAGG - Intronic
1175808845 20:61846526-61846548 ATAGAGATACAGAGACAGAGAGG + Intronic
1175982385 20:62745281-62745303 ACAGAGAAACAGACACATAGAGG + Intronic
1176041513 20:63068407-63068429 GTGAATAAACAGACACAGGTGGG - Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176652463 21:9563459-9563481 AGGAAGAAACAGACACAGGCAGG + Intergenic
1177520789 21:22221404-22221426 TTGGGGAAAAAGACACAGGATGG - Intergenic
1177930506 21:27277126-27277148 ATGGAGAGAGAGAGAGAGGGAGG + Intergenic
1178016854 21:28356727-28356749 TGGGAGAAAGAAACACAGGGAGG - Intergenic
1178305066 21:31484518-31484540 AGGGAGAAACACACAAAGGAAGG + Intronic
1178330952 21:31690661-31690683 ATGGAGATACTGACACAGGAGGG + Intronic
1178342033 21:31793892-31793914 TTGGAGAATTAGCCACAGGGAGG - Intergenic
1178442719 21:32612031-32612053 ATGGAGAAAGAGGGGCAGGGTGG - Intronic
1178918417 21:36722606-36722628 CTGGAGAGACAGAGACGGGGTGG + Intronic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1179921053 21:44507834-44507856 CAGGAGAAACAGGCACGGGGCGG - Intronic
1179922402 21:44514204-44514226 ATGGAGACTCAGACACAGCCAGG + Intronic
1180011937 21:45057090-45057112 CCGGACAGACAGACACAGGGTGG + Intergenic
1180314519 22:11266161-11266183 ATGGAGAGAGAGAGAAAGGGAGG + Intergenic
1181145690 22:20844820-20844842 ATGATGAAACAGACACAGAGAGG + Intronic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181387772 22:22558029-22558051 ATGGGGAAAGGGAGACAGGGTGG + Intronic
1181387820 22:22558153-22558175 ATGGAGGAAGGAACACAGGGTGG + Intronic
1181569524 22:23760542-23760564 GTGGAGAGACAGAGACAGAGGGG + Intergenic
1181744165 22:24944230-24944252 AGGGAGAGAGAGAGACAGGGAGG + Intronic
1181783701 22:25210469-25210491 ATGAAGAAACAGGCTCAGGGAGG + Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1181960584 22:26619222-26619244 GTGGAGACAGAGACACAGAGAGG + Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182250690 22:28997661-28997683 ATGGAGAAACGGAGGCAGAGAGG - Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182747251 22:32615475-32615497 ATGGAGAAATGGAGTCAGGGAGG + Intronic
1183072294 22:35404795-35404817 ATTGAGAAACGGAGACAAGGTGG + Intronic
1183101558 22:35587384-35587406 ATGGAGAAATAGGAACAGTGAGG + Intergenic
1183321628 22:37168521-37168543 ATGCAGAAACAGGCTCAGAGAGG - Intronic
1183365463 22:37404390-37404412 ATGGAGAGAGAGACCAAGGGGGG + Intronic
1183649244 22:39144903-39144925 ATGGAGAAACTGAGACACGGAGG + Intronic
1183746469 22:39694753-39694775 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
1183946998 22:41332245-41332267 ATGGATAAACTGAGACAGGTTGG - Intronic
1184379433 22:44135868-44135890 ACACAGAAACAGACAGAGGGAGG - Intronic
1184574703 22:45353736-45353758 ATGAAGAAACAGACCCAGAGAGG + Intronic
1185258295 22:49848645-49848667 ATGGGGAAACAGAGGCACGGTGG + Intergenic
949254348 3:2027786-2027808 ATGGAGAAACAAACCCATGTTGG + Intergenic
949630877 3:5924717-5924739 ATAGAAAAACAGACAGAGTGGGG + Intergenic
949853837 3:8442048-8442070 ATGGAGCCACAGACACATGGAGG + Intergenic
949896740 3:8772937-8772959 ATGAGAACACAGACACAGGGAGG - Intronic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
950157642 3:10735679-10735701 CTGGAGACAGAGACCCAGGGAGG + Intergenic
950157674 3:10735867-10735889 CTGGAGACAGAGACCCAGGGAGG - Intergenic
950261461 3:11545531-11545553 ATGGACAAGAAGAGACAGGGAGG - Intronic
950347099 3:12306424-12306446 ATGAAGAAACAGGAACAGAGAGG + Intronic
950403550 3:12789745-12789767 ATGGAGGAACAGTCACAGATTGG + Intergenic
950432404 3:12958402-12958424 ACTGAGAAACAGACACAGAGAGG - Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950665042 3:14490214-14490236 ATGAGGAAACAGGCACAGAGAGG - Exonic
950687868 3:14631748-14631770 AGAGAGATGCAGACACAGGGAGG + Intergenic
950970555 3:17182906-17182928 ATGGAGAACAAGGCAAAGGGAGG - Intronic
951051159 3:18095710-18095732 ATGAAGAAACAGGCACAGAAAGG - Intronic
952094928 3:29939494-29939516 ATGGACATACAGACCCAGGGTGG + Intronic
952108503 3:30095971-30095993 AGGGAGAAACAGAGGAAGGGAGG - Intergenic
952144325 3:30515276-30515298 ATGGTGAAAATGACACAGGGAGG - Intergenic
953957646 3:47244145-47244167 ATGCAGAAACAGGCACAGAGCGG + Intronic
953999178 3:47542653-47542675 ATGGAGAAACAGAAACCCTGGGG - Intergenic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
955008477 3:54991765-54991787 ATGAAGAAACAGGCTCAGAGAGG - Intronic
955090589 3:55746650-55746672 AAGGAGAAGGAAACACAGGGTGG + Intronic
955376409 3:58400939-58400961 ATGGAAAAACAGACCCAGTTTGG + Intronic
955480058 3:59380841-59380863 AATGAGAAACATACACAGAGAGG + Intergenic
955553980 3:60116190-60116212 CTGGAGAAAGAGACACATGTTGG + Intronic
955614022 3:60786508-60786530 ATGAAGTAACAGACTCAGGTAGG - Intronic
956066604 3:65403106-65403128 ATGGAGAAACTGAGACAGAGAGG - Intronic
956190689 3:66605187-66605209 ATGAAAAAACAGACATAGAGAGG - Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
957802988 3:85109352-85109374 ATAGAGAAAGAGAGACAGTGGGG + Intronic
957850023 3:85795953-85795975 ATGGGCAAACTGACACTGGGAGG - Intronic
957894690 3:86406629-86406651 ATGAAGAAACTGAAACAAGGAGG - Intergenic
958130077 3:89407517-89407539 ATGGAGAAACAAAGAAAAGGAGG - Intronic
958627679 3:96646763-96646785 ATGGAGGAAGAGGCACAGGCGGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
960038864 3:113129038-113129060 ATGGAGAAAAGGGCACAGGGAGG + Intergenic
960701288 3:120441854-120441876 ATGGGGAAACAGGCTCAGAGAGG + Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961062317 3:123840989-123841011 ACGAAGAAACAGATACATGGTGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961328765 3:126126904-126126926 ATGGAGAGACAGACTCACAGTGG + Intronic
961359571 3:126358333-126358355 ATGAAGAAACCGACTCAGAGAGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961538594 3:127585473-127585495 GAGGAGGAACAGAGACAGGGAGG + Intronic
961827020 3:129604443-129604465 ATGAAGAAACAGGCACAGAGAGG - Intronic
962298001 3:134211276-134211298 ATGCAGAAAAAGAGACAGGGAGG + Intronic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962341960 3:134593414-134593436 ATGAGGAAACAAAAACAGGGAGG + Intergenic
962479203 3:135783956-135783978 ATGAGGAAACAGGCACAGGGAGG - Intergenic
962970490 3:140396579-140396601 ATGAGGAAACAGGCACAGAGAGG + Intronic
963274988 3:143320911-143320933 ATAGAGACACAGACACATGGAGG + Intronic
963345924 3:144096732-144096754 AAGGAGAGAGAGACTCAGGGTGG - Intergenic
963597149 3:147342627-147342649 TTGGAGCAAAAGAAACAGGGTGG + Intergenic
963972223 3:151442899-151442921 ATGGAAAAAGTGACACAGTGAGG - Intronic
963997965 3:151733023-151733045 ATGTTGAAACAGAAACTGGGTGG + Intergenic
964494214 3:157271179-157271201 ATTGAGTAACAGTCACAGAGAGG + Intronic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
965526048 3:169719477-169719499 GTGAACACACAGACACAGGGAGG - Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965707780 3:171526369-171526391 ATAGAGATACATTCACAGGGTGG + Intergenic
965845015 3:172951554-172951576 TGGGAAAAACAGACACAAGGGGG - Intronic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966586265 3:181629025-181629047 ATGAAGAAACAGGCTCAGAGAGG - Intergenic
966595479 3:181721479-181721501 AAGGAGAAATAGAGAAAGGGAGG - Intergenic
966660998 3:182414807-182414829 ATGGAGAAACAGACCCAGTTTGG + Intergenic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
966863829 3:184245333-184245355 ATGAAGAAAAAGACGAAGGGAGG + Exonic
966936632 3:184714358-184714380 ATGGGAAAACAGTCACAGAGAGG + Intergenic
966945989 3:184777424-184777446 ATGAGGAAACAGGCCCAGGGAGG + Intergenic
967191297 3:186987165-186987187 AAAGAGAAAGAGAGACAGGGAGG + Intronic
967923779 3:194631306-194631328 CTGGAGACACCGAGACAGGGTGG + Intronic
967980773 3:195063896-195063918 ATGAAGAAACAGGCCCAGAGAGG + Intergenic
967996207 3:195168603-195168625 AAGGAGAACCAGAGACTGGGAGG + Intronic
968112832 3:196063481-196063503 ATGGAGAAAAAGATACAGTGAGG - Intronic
968469648 4:773557-773579 ATGGAGAGACAGACGCGGGTGGG + Intergenic
969111097 4:4844773-4844795 ATGTGGAAACAGACACACAGAGG + Intergenic
969176400 4:5402307-5402329 ATGGAGCCACAGGCACAGGCCGG + Intronic
969296694 4:6274448-6274470 ATGGGGAAACAGACACAGTGAGG + Intronic
969435419 4:7186451-7186473 GTGGAGAGAGAGCCACAGGGCGG - Intergenic
969780699 4:9400595-9400617 CTGGAGAAGAAAACACAGGGTGG + Intergenic
969871362 4:10107053-10107075 ATGGGGAAAACGAGACAGGGAGG + Intronic
969906800 4:10404732-10404754 ATGAGGAAACAGGCACAGAGAGG + Intergenic
969935561 4:10677069-10677091 ATGGAGAAACAATCACAGTTGGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970270174 4:14338159-14338181 ATGAAGAAAAGGACACTGGGAGG + Intergenic
970440371 4:16076507-16076529 ATGAGGAAACTGACACAGAGAGG + Intronic
970563860 4:17311676-17311698 ATAGGGAAACAGAGAAAGGGTGG - Intergenic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971676366 4:29634405-29634427 ATGGACACAGGGACACAGGGAGG - Intergenic
971734249 4:30425661-30425683 AGGGAGAAAGAGATGCAGGGAGG + Intergenic
972333138 4:38081767-38081789 ATGAGGAAACTGACACAGAGGGG + Intronic
972621495 4:40751422-40751444 ATGGAAAGAAATACACAGGGAGG - Intronic
973088203 4:46095981-46096003 AAGGAATAACAGACACTGGGTGG - Intronic
973633852 4:52843955-52843977 AGTGTGAAACAGTCACAGGGTGG - Intergenic
973972449 4:56226903-56226925 AAGGAGAAGAAGCCACAGGGAGG - Intronic
974491083 4:62565977-62565999 ATGAGAACACAGACACAGGGAGG - Intergenic
975973061 4:80065496-80065518 ATGGACTAACAGACATATGGAGG + Intronic
976926194 4:90499902-90499924 ATGGAAAAACACAAACATGGAGG + Intronic
978608322 4:110507480-110507502 AGGCAGAAACAGATACAGGGAGG - Intronic
978733805 4:112062514-112062536 AAGGAGAGAAAGACAGAGGGAGG + Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979409193 4:120353860-120353882 CTTGAGAAACAGACATAGGAAGG - Intergenic
979461086 4:120984907-120984929 AAGAACACACAGACACAGGGAGG - Intergenic
980713662 4:136603681-136603703 ATGCCTAAACAGAGACAGGGTGG + Intergenic
980862544 4:138516990-138517012 ATGAGGAAACAGATACAGAGAGG - Intergenic
981590784 4:146358186-146358208 ATGTAGAATCAGATACATGGGGG - Intronic
981843643 4:149141367-149141389 ATTGAGAAACACACAAAGAGAGG - Intergenic
981932918 4:150209667-150209689 ATTTGGAAACAGACACAGGATGG + Intronic
982079731 4:151777687-151777709 ATGAAGAAAGAGATACAGGGAGG - Intergenic
982246060 4:153352456-153352478 ATGAAGAAACAGACATAGAGAGG - Intronic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
982792443 4:159608924-159608946 ATTGGTAGACAGACACAGGGAGG + Intergenic
982882089 4:160731948-160731970 AGAGAGAAAGAGACAGAGGGAGG - Intergenic
982995055 4:162333145-162333167 ATAGAGAAAGAGATACAGGTGGG + Intergenic
983724486 4:170903464-170903486 TTGAAGAAACAGCCACATGGAGG - Intergenic
984036981 4:174681491-174681513 ATGGAAACACAGACACACAGGGG + Intronic
984331811 4:178330521-178330543 AATGAGAAACAGACACAGCTTGG - Intergenic
984506353 4:180623784-180623806 ATGGAGAAAAATACCCAGGCTGG - Intergenic
984810436 4:183791672-183791694 AGGGACAGACAGAAACAGGGAGG - Intergenic
985412135 4:189696020-189696042 GTGGAGGGACAGACACAGGCGGG - Intergenic
985661634 5:1160127-1160149 AGGGAGAGAGAGACACAGAGAGG + Intergenic
985666956 5:1186311-1186333 AGAGAGAAACAGAGACAGAGAGG - Intergenic
986314437 5:6576963-6576985 ACAGAGAAACAGGGACAGGGAGG + Intergenic
986583367 5:9288518-9288540 AGGCAGAAACAGACGCTGGGAGG + Intronic
986736115 5:10668576-10668598 ATGGGGAAATAGATACAGAGAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987987692 5:25170276-25170298 GTGAACACACAGACACAGGGAGG - Intergenic
988030267 5:25754746-25754768 AAGGAGAAACAGTCACATAGTGG - Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
988633068 5:32951881-32951903 ATGGACACACACACACAGAGTGG + Intergenic
988645170 5:33087182-33087204 ATTAAGAAACAAACACAGGCCGG + Intergenic
988979656 5:36553941-36553963 AAGGAGAGGCAGACTCAGGGTGG + Intergenic
989094226 5:37766388-37766410 AGAGAGAAACACACACAGAGGGG + Intergenic
990199651 5:53357132-53357154 ATGGAAAAACAGGCACTGTGAGG - Intergenic
990321459 5:54633572-54633594 ATGGAGAAACTGAGACACAGGGG - Intergenic
992116411 5:73542505-73542527 AGAGAGAAACAGAGACAGAGAGG + Intergenic
992501312 5:77347031-77347053 ATGGATAGACAGACACAGATAGG - Intronic
992771797 5:80055527-80055549 ATGGAGAAACAGACAATATGTGG - Intronic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993480268 5:88415707-88415729 ATGGAAATATAGACAAAGGGTGG + Intergenic
993526661 5:88973674-88973696 AGGGAAAAAGAGAGACAGGGAGG + Intergenic
993900824 5:93583473-93583495 ATGGAGTAAAAGAGACAAGGAGG - Exonic
994571170 5:101515847-101515869 ATTTAGACACAGACACAGAGGGG + Intergenic
995557167 5:113341631-113341653 ATGGAGAATCACACACTGTGGGG - Intronic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996681152 5:126229098-126229120 GTGGAGGAACAGGCACAGGCAGG + Intergenic
996813746 5:127550309-127550331 ATGAATAAAAAGAAACAGGGAGG - Intronic
997233624 5:132260053-132260075 ATGGAGACCCAGGCACAGAGAGG + Intronic
997646497 5:135485627-135485649 ATGGGGAAACAGACCCTAGGAGG - Intergenic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997837383 5:137206568-137206590 GTGAAGAAACAGACACACGGTGG - Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
997996113 5:138587763-138587785 ATGGAGACACAAAGAAAGGGTGG - Intergenic
998532559 5:142899452-142899474 ATAGAGAAGGAGGCACAGGGAGG + Intronic
998637494 5:143972156-143972178 ATAGAGACACAGACACAAGGAGG - Intergenic
998742586 5:145221780-145221802 ATGGAGAAACAAGCACAGAGAGG - Intergenic
999071262 5:148746097-148746119 GTGAACACACAGACACAGGGAGG - Intergenic
999212509 5:149902370-149902392 ATGGGGAAAGAGACACCGAGTGG - Intronic
999665024 5:153904039-153904061 ATGGGGAAACAGGCTCAGAGAGG + Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000123082 5:158216481-158216503 AAGAACACACAGACACAGGGAGG - Intergenic
1000228444 5:159292643-159292665 GTGGACACATAGACACAGGGAGG + Intergenic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000585771 5:163096795-163096817 ACAGAGAAAAAGACAGAGGGAGG + Intergenic
1000997172 5:167971227-167971249 ATGGAGATAGAGATAAAGGGAGG + Intronic
1001143697 5:169166021-169166043 ATAAAGAAACAGAAACAGGGAGG + Intronic
1002466298 5:179410493-179410515 ATGGGGACACAGTCACAGCGAGG + Intergenic
1002480758 5:179499234-179499256 AAGGAGAAACAGACACTGAAAGG + Intergenic
1002580417 5:180206875-180206897 TTGCAGAAAGAGACACAGGAAGG + Intronic
1002640165 5:180626959-180626981 ATGGGCAAACAGACACAGCAAGG - Intronic
1002665321 5:180819163-180819185 GTGGGGAAACAGGCACAGAGAGG - Intergenic
1003502129 6:6711610-6711632 ATGAGGACACAGACACATGGAGG - Intergenic
1003605136 6:7553018-7553040 ATTAAAAAACAGAGACAGGGAGG - Intronic
1004347642 6:14863364-14863386 TTGGAAAAACAGAAACAGAGAGG + Intergenic
1004726492 6:18316058-18316080 GGGGAGAAAGAGACAGAGGGAGG - Intergenic
1004775415 6:18838847-18838869 ATGGAGAATCAGACCTATGGAGG - Intergenic
1004958936 6:20763279-20763301 CTGGAGAAAGATAAACAGGGAGG - Intronic
1004983617 6:21055561-21055583 GTGAACACACAGACACAGGGAGG - Intronic
1005279070 6:24251659-24251681 ATAGAAATAGAGACACAGGGAGG - Intronic
1006150583 6:31984892-31984914 AGGGAGAAACAGTGAAAGGGAGG + Intronic
1006156884 6:32017630-32017652 AGGGAGAAACAGTGAAAGGGAGG + Intronic
1006223218 6:32513164-32513186 AGGGAGAAACAGTGAAAGGGTGG - Intergenic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006495215 6:34417992-34418014 ATGGAGAAACTGAGGCAGAGGGG + Intronic
1006538810 6:34722581-34722603 ATGGAGACACAGACTCAAAGAGG + Intergenic
1006565058 6:34949001-34949023 ATGAGGAAACAGACACAGTCAGG - Intronic
1006912599 6:37573168-37573190 ATGGAAAAACAGAAACAGAAAGG - Intergenic
1006945783 6:37783700-37783722 ATGGAGAGACAGGGGCAGGGAGG - Intergenic
1007274803 6:40665467-40665489 ATGGAGAAGCAGTCAAAAGGGGG + Intergenic
1007415544 6:41689286-41689308 ATGGAGTAAGAGACACAGACAGG + Intronic
1007749567 6:44063661-44063683 CTGGGGAAACAGGCACAGAGAGG + Intergenic
1008016798 6:46529660-46529682 AAGAGGAAACAGACACAGAGAGG - Intergenic
1009462276 6:63928066-63928088 ATTGAGAAAAGGACACAGAGAGG - Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010085836 6:71917078-71917100 ATAGAGAAACAAGCACAGAGAGG - Intronic
1010292035 6:74148398-74148420 ATAAAGAAACAGAAACAGGGAGG - Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1011585753 6:88923559-88923581 GCAGAGAAACAGACGCAGGGAGG + Intronic
1011708747 6:90029496-90029518 ATAAAGAAACATAAACAGGGAGG - Intronic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013011463 6:106124664-106124686 ATGGAGAGCGAGACACAAGGAGG + Intergenic
1013295669 6:108756294-108756316 CAGGAGAAAAAAACACAGGGAGG - Intergenic
1013545072 6:111148729-111148751 AAGGCCACACAGACACAGGGTGG - Intronic
1016202219 6:141426508-141426530 CTGGAGAAGAAGACACATGGAGG - Intergenic
1016903267 6:149123169-149123191 ATGGAGAAACAGCCAGCTGGTGG - Intergenic
1017001516 6:150000501-150000523 ATGGATATACAGACACAGACAGG + Intergenic
1017009660 6:150054713-150054735 GTGGAGCTACAGACCCAGGGAGG - Intergenic
1017185259 6:151594296-151594318 ATGAGGAAACAGAGACAGAGAGG - Intronic
1017853042 6:158322335-158322357 ATGGAAAAACAGAAACAGAAAGG - Intronic
1017969387 6:159298608-159298630 ATGGAGAAAAGGAGACAGAGAGG - Intergenic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1019013806 6:168864935-168864957 ATGGAGAAAGAGACAGAGAGAGG + Intergenic
1019018416 6:168897337-168897359 GTGGAGAAAGAGACAGAGAGGGG - Intergenic
1019026252 6:168965706-168965728 ATGAAGAAACAGACCCAAAGAGG + Intergenic
1019362318 7:611266-611288 ATGGAGAGAGAGACAGAGAGAGG - Intronic
1019512286 7:1423747-1423769 AGGGAGAGACAGAGACAGAGAGG + Intergenic
1019512320 7:1423917-1423939 AGGGAGAGACAGAGACAGAGAGG + Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019772802 7:2894376-2894398 ATGAAGAAGGAGACACAGAGAGG - Intergenic
1019963834 7:4483234-4483256 TTTTAGAAACAGAGACAGGGAGG - Intergenic
1020808906 7:12827320-12827342 ATAGGAAAACAGACTCAGGGAGG + Intergenic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021571688 7:22072464-22072486 ACAGAGAGACAGAGACAGGGAGG - Intergenic
1022419925 7:30210700-30210722 AGGGCGACACAGACACAGGAGGG + Intergenic
1022620538 7:31979515-31979537 TTGAGGAAACAGCCACAGGGAGG + Intronic
1023924658 7:44657989-44658011 ATGGAAAAACAGACACACAAAGG - Intronic
1024979398 7:55144849-55144871 ATGACGAAACAGAGACACGGAGG - Intronic
1025073263 7:55920004-55920026 ATGGAGGAACAGCCAGATGGTGG - Intronic
1025233313 7:57217393-57217415 ATGGAGCCGCAGACCCAGGGAGG + Intergenic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1026610405 7:71854206-71854228 ATGGAGAGAAAGAAACAGGCCGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027257743 7:76442032-76442054 ATTCGGAAGCAGACACAGGGTGG - Exonic
1027281105 7:76610003-76610025 ATTCGGAAGCAGACACAGGGTGG + Exonic
1027353651 7:77336381-77336403 ATTGAGGAACAGACCCAGGATGG - Intronic
1027482587 7:78717216-78717238 ATGGAGAAAAAAAGACAAGGAGG - Intronic
1027615129 7:80413394-80413416 AAGAAGAAACAGACAGAAGGAGG - Intronic
1027694625 7:81394805-81394827 ATGGAAAAAAAGAGAGAGGGAGG + Intergenic
1027758097 7:82241633-82241655 ATGGAGAAAGAAGCAGAGGGGGG + Intronic
1027878188 7:83798742-83798764 ATGGAGAAACCCACACATAGAGG + Intergenic
1027916325 7:84327391-84327413 AAGGAGAAAGAGAGAAAGGGAGG + Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028744366 7:94310487-94310509 ATAGAGAAACAGAGAGAGAGAGG - Intergenic
1028759390 7:94478513-94478535 ATGTTGAAACAGAGACAGGTGGG + Intergenic
1028970602 7:96854410-96854432 ATGAAGAAAGTGAAACAGGGAGG + Intergenic
1029605033 7:101593503-101593525 AGGGAAAACCAGACACAGAGAGG + Intergenic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1032114810 7:129107926-129107948 ACACAGAGACAGACACAGGGAGG - Intergenic
1032146689 7:129389231-129389253 ATGGACAAAAAGACACAGGTAGG - Intronic
1032189154 7:129753238-129753260 ATTGAGAAACTGACCCAGAGAGG - Intronic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033049468 7:137990977-137990999 ATGGAAAAACAGAGACACAGAGG - Intronic
1033306146 7:140227195-140227217 GTAGGGAAACAGCCACAGGGAGG - Intergenic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033611303 7:142965522-142965544 ATGGAGAAACAGATCATGGGGGG + Intergenic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034474002 7:151272438-151272460 AGGGAGAGGAAGACACAGGGAGG - Intronic
1034985271 7:155509515-155509537 AGGGAGAGACAGAGAGAGGGAGG + Intronic
1035206728 7:157298506-157298528 ATTGAGACACAGGGACAGGGAGG + Intergenic
1035304030 7:157918452-157918474 AACGAGAAACACACACAGTGAGG + Intronic
1035727599 8:1834409-1834431 CTGGAGACACAGGCCCAGGGAGG + Intronic
1035818388 8:2564865-2564887 ATTGAGAAACAGAGAGAAGGTGG + Intergenic
1035832447 8:2711877-2711899 ACGGTGAAACAGAGACAGAGAGG + Intergenic
1036638417 8:10566944-10566966 ATGGGGGCAGAGACACAGGGTGG - Intergenic
1037164814 8:15813950-15813972 TTGAAGAAACAGACACACAGAGG - Intergenic
1037318360 8:17620418-17620440 ATGGAGAAAAAGATACAGGGTGG + Intronic
1037461035 8:19109700-19109722 AGGGAGAAAGAGAGAGAGGGGGG - Intergenic
1037472503 8:19224440-19224462 AGGGAGAAAGAGACAGAGTGTGG + Intergenic
1037747116 8:21654565-21654587 AAGGAGAAACAGAGACTGGCTGG - Intergenic
1038012464 8:23486046-23486068 AGGGAGAAAGAGAGTCAGGGAGG - Intergenic
1038601960 8:28953279-28953301 CTTGAGAGACAGACACATGGAGG - Intronic
1038967047 8:32585978-32586000 ATGAAGAAACAGAAACAGAGAGG - Intronic
1038968994 8:32609632-32609654 AGAGAGAGACAGACAGAGGGAGG - Intronic
1039440792 8:37594087-37594109 AGGGAGAAAAAGGCAGAGGGAGG + Intergenic
1039451156 8:37675889-37675911 ATGGAGAGAGAGAGAGAGGGAGG - Intergenic
1039737072 8:40344418-40344440 ATGAAGAAACAGAGACTGAGAGG + Intergenic
1041213663 8:55578556-55578578 ATGGTGAAACAGACCCATAGAGG + Intergenic
1041463055 8:58132572-58132594 ATGGGGAAGCAGAGACATGGAGG - Intronic
1041794261 8:61729536-61729558 ATGGAGAAACATGCTCAGAGAGG + Intergenic
1042121735 8:65495766-65495788 ATGGCAAACCAGGCACAGGGTGG + Intergenic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1042379845 8:68100856-68100878 ATGGAGAAATAGAGACTGGTAGG + Intronic
1042795082 8:72653066-72653088 AAGGGGATACAGACACAGAGAGG - Intronic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1043487272 8:80710393-80710415 ATGAGGAAACAGCCACAGAGAGG + Intronic
1043588096 8:81793395-81793417 ATGGAGACACTTACAGAGGGAGG - Intergenic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044274035 8:90279502-90279524 ATGTAGAAAGAGAGACAGGCAGG - Intergenic
1044938821 8:97319592-97319614 ATGAAGAAACAGGCCCAGTGAGG - Intergenic
1045248181 8:100461215-100461237 TTAGGGAAACAGACACAGAGAGG - Intergenic
1045253620 8:100501471-100501493 AGGGAGAAGCGGAGACAGGGAGG + Intergenic
1046039385 8:108883895-108883917 ATGGAGAAACCCACTCATGGTGG - Intergenic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048746486 8:137620003-137620025 AGGGAGGAAGAGACAGAGGGAGG - Intergenic
1048990695 8:139758537-139758559 ATGGGGATGCAGACACAGGGAGG + Intronic
1049178320 8:141207210-141207232 ACAGAGAAACAGACACAAGGAGG + Intronic
1049371889 8:142271854-142271876 ATGAGGAAACAGACCCAGAGAGG + Intronic
1049402961 8:142438759-142438781 ATGGAGACAGACACTCAGGGAGG - Intergenic
1050785643 9:9398106-9398128 AGGGAGAAAGAGAAGCAGGGAGG - Intronic
1051189878 9:14500160-14500182 ATGAGGAAACAGGCACAGAGAGG + Intergenic
1051901301 9:22044702-22044724 ATGGGGATACAGGCACAGGAAGG - Intergenic
1051989382 9:23133119-23133141 AAGGAGAAAAAGAAACAGAGTGG + Intergenic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052760561 9:32586841-32586863 ATGGAGAAACAGCCAGTTGGTGG + Intergenic
1052937678 9:34106505-34106527 AGGGAGTAACAGGTACAGGGAGG + Intronic
1053055114 9:34989449-34989471 TTGGTGAAAAAGACAGAGGGCGG - Intergenic
1053096096 9:35329353-35329375 ATGAGGACACAGACACAGAGAGG + Intronic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1054827802 9:69590426-69590448 ATGAACAAATAGACCCAGGGAGG - Intronic
1055644937 9:78354529-78354551 ATGGAGAGAGAGGCACAGAGAGG - Intergenic
1056069225 9:82968566-82968588 ATGTAGAGGCACACACAGGGAGG - Intergenic
1056200687 9:84273156-84273178 ATGGGGAAACTGAGACAGAGTGG + Intergenic
1057187438 9:93064809-93064831 GTGGAGACACAGGCCCAGGGTGG + Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057317054 9:93976243-93976265 ATGTAGGATCAGACACAGGAGGG - Intergenic
1057479366 9:95432504-95432526 ATGGGGAAACAAGCTCAGGGGGG - Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058816129 9:108684353-108684375 ATGGAGAATGAGACTCAGAGAGG + Intergenic
1058989747 9:110243364-110243386 GTGAGGAAACAGACAAAGGGTGG - Intergenic
1059104488 9:111500037-111500059 GTGGAGGAACAGTCTCAGGGTGG + Intergenic
1059310334 9:113384422-113384444 ATGGGGAGACAGACCCAGAGAGG - Intergenic
1059513789 9:114874436-114874458 ATGGGAAAACAGACACAGCAAGG + Intergenic
1059649198 9:116299352-116299374 AGGTAGAAATAGACACAGGTAGG - Intronic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1060048270 9:120358419-120358441 ATGAGGAAACAGACCCAGAGAGG + Intergenic
1060069968 9:120537663-120537685 ATGATGAAACAGGCACAGTGTGG - Intronic
1060204183 9:121672897-121672919 TTGGGCAAACAGACACTGGGAGG - Intronic
1060268626 9:122126546-122126568 AGGGAGAAAGAGACACCGGGAGG + Intergenic
1060391549 9:123281766-123281788 ATAGAGAAACAGACTCAGTGGGG + Intergenic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1060502509 9:124172282-124172304 AAATAGAAAGAGACACAGGGAGG - Intergenic
1060567734 9:124608332-124608354 GTGAACACACAGACACAGGGAGG - Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060978258 9:127777856-127777878 AAAGAGAAACAGAAACAAGGCGG + Intronic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061195111 9:129103228-129103250 ATGAAGAAGCACACACAGGCTGG - Intronic
1061503410 9:131016716-131016738 ATGAAGAAAAAGACACAAGTTGG + Intronic
1061509019 9:131049158-131049180 CAGGAGGAACCGACACAGGGCGG - Intronic
1061779910 9:132989335-132989357 TTGGAGACCCAGACCCAGGGAGG - Intronic
1062080366 9:134620388-134620410 AGAGAGAAACACACACAGTGGGG + Intergenic
1062167251 9:135114026-135114048 GAGGGGACACAGACACAGGGAGG - Intronic
1062226843 9:135457210-135457232 ATGGAGAAACAGAGGCACAGGGG - Intergenic
1062353030 9:136148420-136148442 ATGAAGACACACACACGGGGCGG + Intergenic
1062562028 9:137145956-137145978 ACGGAGCCACAGACACAAGGCGG - Intronic
1203630193 Un_KI270750v1:67000-67022 AGGAGGAAACAGACACAGGCAGG + Intergenic
1203670459 Un_KI270755v1:6961-6983 GTGGAGGGACAGACACAGGCGGG + Intergenic
1185538472 X:882885-882907 AGAGAGAAACAGAGACAGAGAGG + Intergenic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185595835 X:1306255-1306277 ACAGAGAAACAGAGAGAGGGAGG + Intronic
1185609886 X:1387890-1387912 ATGAGGACACAGACACACGGAGG + Intronic
1185613724 X:1407754-1407776 AAAGAGAGACAGAGACAGGGTGG + Intronic
1185831338 X:3305662-3305684 AAGGGGACACAGACACAGAGGGG - Intergenic
1185873359 X:3682613-3682635 AAGGAGACACAGACGCAGAGGGG + Intronic
1186955344 X:14675515-14675537 TTGCAGAAACAGACACTGAGTGG - Intronic
1187441332 X:19323318-19323340 ATGAAGAAACAGGCACATGGGGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188116379 X:26249556-26249578 ATGGACACATGGACACAGGGAGG + Intergenic
1188368415 X:29338714-29338736 ATGGAGAGACAGACAGAGACAGG - Intronic
1188388619 X:29592032-29592054 ATGGGGAAACTCACACAGGATGG + Intronic
1189141905 X:38616003-38616025 ATGCAGAAACAGGCCCAGAGAGG - Intronic
1189181973 X:39012994-39013016 ATGGAGAGACACTGACAGGGGGG + Intergenic
1190119467 X:47648802-47648824 ATGAAGAAAAAGGCACAGAGAGG + Intronic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1191588075 X:62850615-62850637 CTGGGGAAACAACCACAGGGTGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1193744840 X:85264792-85264814 ATGAGGAAACAGACAGAAGGGGG - Intronic
1193833558 X:86316205-86316227 ATCTAGAAGCAGACACAGGGGGG - Intronic
1194861973 X:99010689-99010711 AGAGAGAAAGAGAGACAGGGAGG + Intergenic
1195009116 X:100718001-100718023 ATGGGGAAACAGACTCAAGGAGG - Intronic
1195029996 X:100917518-100917540 AGGGAGAAAGAGAGAAAGGGAGG + Intronic
1195091394 X:101463081-101463103 ATGGAGAAAGAGAGACAGAATGG - Intronic
1195173867 X:102296170-102296192 AAGGAGACACAGACACATAGGGG + Intergenic
1195184998 X:102390923-102390945 AAGGAGACACAGACACATAGGGG - Intronic
1195289218 X:103414981-103415003 AGGGAGATACAGATACTGGGTGG - Intergenic
1195656995 X:107341215-107341237 ATGGAGAAAGAGACAAAAGATGG + Intergenic
1197013304 X:121593621-121593643 ATGAAGGAACAGAGGCAGGGTGG - Intergenic
1197173329 X:123458327-123458349 ATGGAGAAATGGAAACAGAGAGG + Intronic
1197230475 X:123998533-123998555 ATGGAGAAACTGAAACTGTGGGG - Intronic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1197801985 X:130360216-130360238 ATAGAGAAACAAACACAATGAGG - Intronic
1198079611 X:133226869-133226891 ATGGACACATGGACACAGGGAGG - Intergenic
1198741192 X:139844829-139844851 ATGGGAAAACAGACTCAGAGAGG - Intronic
1199665835 X:150095719-150095741 ATGAGGAAACAGAGACAGGGAGG - Intergenic
1199935928 X:152573632-152573654 GAGGAGATAAAGACACAGGGAGG + Intergenic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1200114416 X:153763949-153763971 ATCCAGAAACAAACACAGGTTGG - Intergenic
1200136884 X:153879578-153879600 GTAGAGAGACAGACAGAGGGTGG + Intronic
1200227161 X:154424597-154424619 AAAAAGAGACAGACACAGGGAGG - Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200737840 Y:6819380-6819402 GTGGAGAAATAGGAACAGGGAGG + Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201394234 Y:13531039-13531061 ATGAACACATAGACACAGGGAGG - Intergenic
1201676142 Y:16586667-16586689 AAGGAGAAAGAGACAAAGAGAGG - Intergenic