ID: 1104915584

View in Genome Browser
Species Human (GRCh38)
Location 12:132262759-132262781
Sequence AGGTGCAGACAGATGAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 2, 1: 0, 2: 0, 3: 19, 4: 212}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104915584_1104915588 -4 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915588 12:132262778-132262800 ACCTGCAGGAGACACGGTTTGGG 0: 2
1: 1
2: 1
3: 5
4: 122
1104915584_1104915591 2 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915591 12:132262784-132262806 AGGAGACACGGTTTGGGGTGTGG 0: 2
1: 1
2: 2
3: 31
4: 318
1104915584_1104915597 29 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915597 12:132262811-132262833 GGCGCAGCATGAGGGACCCCGGG 0: 2
1: 0
2: 1
3: 12
4: 182
1104915584_1104915586 -10 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915586 12:132262772-132262794 GTCTGCACCTGCAGGAGACACGG 0: 2
1: 1
2: 2
3: 27
4: 269
1104915584_1104915587 -5 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915587 12:132262777-132262799 CACCTGCAGGAGACACGGTTTGG 0: 2
1: 1
2: 1
3: 5
4: 111
1104915584_1104915596 28 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915596 12:132262810-132262832 GGGCGCAGCATGAGGGACCCCGG 0: 2
1: 0
2: 1
3: 23
4: 169
1104915584_1104915593 8 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915593 12:132262790-132262812 CACGGTTTGGGGTGTGGTCAGGG 0: 1
1: 2
2: 2
3: 12
4: 147
1104915584_1104915590 -3 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915590 12:132262779-132262801 CCTGCAGGAGACACGGTTTGGGG 0: 2
1: 1
2: 0
3: 17
4: 144
1104915584_1104915595 21 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915595 12:132262803-132262825 GTGGTCAGGGCGCAGCATGAGGG 0: 1
1: 2
2: 0
3: 27
4: 158
1104915584_1104915592 7 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915592 12:132262789-132262811 ACACGGTTTGGGGTGTGGTCAGG 0: 1
1: 2
2: 0
3: 6
4: 98
1104915584_1104915594 20 Left 1104915584 12:132262759-132262781 CCATAGCTCATCTGTCTGCACCT 0: 2
1: 0
2: 0
3: 19
4: 212
Right 1104915594 12:132262802-132262824 TGTGGTCAGGGCGCAGCATGAGG 0: 1
1: 2
2: 2
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104915584 Original CRISPR AGGTGCAGACAGATGAGCTA TGG (reversed) Intronic
900655660 1:3755578-3755600 AGGTGCAGGCAGAGGCCCTAGGG - Intronic
900992641 1:6104936-6104958 AGGTGCAGACAGGTCAGGTAGGG + Exonic
901125958 1:6928819-6928841 AGGAGCAAACAGAGGAGCTGGGG - Intronic
903462346 1:23528718-23528740 AGGTACAGACAGATGTACTTGGG + Intronic
903776691 1:25798503-25798525 AGGGGAAGATTGATGAGCTAAGG - Intergenic
905456003 1:38088271-38088293 AGGTGGTGACAGGTGAGCTGAGG + Intergenic
907322647 1:53615253-53615275 AGGTGCATCCACATGAGATAAGG + Intronic
908106742 1:60852262-60852284 AGGTACCCACAAATGAGCTATGG + Intergenic
909487597 1:76191037-76191059 ATGTGCAGACAGATTATCTGAGG - Intronic
910118644 1:83760353-83760375 AGCTTCAAAGAGATGAGCTACGG + Intergenic
910367931 1:86486572-86486594 TGCTGCAGACAGTTGAGCTGGGG + Exonic
911456245 1:98127838-98127860 AGGTGCAAACAGATGTGGTACGG + Intergenic
912103024 1:106234691-106234713 AAGTGGAGACGGATGAGATAGGG - Intergenic
913012253 1:114695615-114695637 AAGTGGAGAGAGATGAGCTTTGG + Intronic
913252821 1:116926108-116926130 AGGAGCAGACAGTGGATCTAGGG + Intronic
913287239 1:117237759-117237781 AGGATCAGACAGAGAAGCTAAGG - Intergenic
913546209 1:119871511-119871533 AGGTGGAGACAGATGAGAAAAGG + Intergenic
916084972 1:161261928-161261950 AGATGCAGACAGATGTGCACAGG - Intronic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
922613035 1:226944067-226944089 AGGTGGAGAAAGAGGAGCTGGGG + Intronic
922786577 1:228285859-228285881 AGGTGCAGAGAGGTGGGCTCGGG + Intronic
923681559 1:236122774-236122796 AGGTGTGGACAGAGGAGCAAGGG - Intergenic
1062907617 10:1189464-1189486 AGGTGAAGACACATGTGCTCAGG + Intronic
1062970705 10:1646113-1646135 AGGTGCACACAGGTGAGTTAGGG + Intronic
1064256497 10:13746917-13746939 TAGGGCCGACAGATGAGCTATGG + Intronic
1064593189 10:16915685-16915707 AAGTGCAGACTAATGAGCTTTGG - Intronic
1065634400 10:27715833-27715855 AAGGGCAGACAGAGGACCTATGG + Intronic
1066670767 10:37836381-37836403 AGGAGAAGAAACATGAGCTATGG - Intronic
1070830357 10:79414497-79414519 AGCTGCAGTCACATGACCTAGGG + Intronic
1076947421 10:133660692-133660714 AGGTGCAGACAGCTGGCCTTGGG - Intergenic
1079373187 11:19869689-19869711 AGGTGCAGCCTAATGAGCTTGGG - Intronic
1080549997 11:33365656-33365678 AGGTGCAGCCAGAGGAACTCAGG - Intergenic
1082749465 11:57001126-57001148 ATGTGCAGACAGATGATCTGAGG - Intergenic
1083272460 11:61579339-61579361 AGGTCCAGACAGATGAGGGGAGG + Intronic
1089048983 11:115529432-115529454 AAGTTCAGACAGATGAGCAGTGG + Intergenic
1089564369 11:119363333-119363355 AGGTGCAGACAGGTGACAGAGGG - Intronic
1090836139 11:130455516-130455538 AGGTGCAAACAGAAGTGCAAGGG + Intronic
1090856681 11:130614880-130614902 AGCTGCAGACAGGTGAGAGAGGG + Intergenic
1091970774 12:4785093-4785115 ATGTGCAGAGAGCTGTGCTAGGG - Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1095093716 12:38132072-38132094 AAGTGAACACAGATGAGCTGGGG + Intergenic
1095629802 12:44362254-44362276 AGGTGCTGTGATATGAGCTATGG - Intronic
1097770835 12:63582853-63582875 TGGAGCAGGCAGAGGAGCTAGGG + Intronic
1099336134 12:81360606-81360628 AGGTGAGGAGAGATAAGCTAAGG - Intronic
1099533843 12:83821593-83821615 AGGTGCAGAGAGCTTAGGTAAGG + Intergenic
1100220264 12:92497436-92497458 AGAGGCAGTCAGATGACCTAAGG + Intergenic
1101420546 12:104547241-104547263 AGTTGCAGGCAGATGGGCCAAGG + Intronic
1101876643 12:108600385-108600407 AGGGGAAGGCAGAGGAGCTAGGG + Intergenic
1102747057 12:115258461-115258483 AGGTGGAAACAGAAGAGGTAGGG + Intergenic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1105543847 13:21337704-21337726 AGGTGAAGACAGATGAGGCTAGG - Intergenic
1106798179 13:33229270-33229292 AGGGGAAGACAGTTGAGATACGG + Intronic
1107011558 13:35675623-35675645 AGGAGCTGACAGATGATCTGGGG + Intergenic
1108193480 13:47967606-47967628 AGGGGCAGGCAGATTACCTAAGG + Intronic
1110426351 13:75371447-75371469 AGGTGCAGGCAGATGGGTGATGG + Intronic
1114738402 14:25067557-25067579 AGGTGAAAACAGATGAGAAAAGG + Intergenic
1114826275 14:26084347-26084369 GGGTGCAGACAGATTATCTTAGG + Intergenic
1119599746 14:75967569-75967591 AGGTGCAGACAGCTGTGTTGGGG + Intronic
1121328514 14:93035491-93035513 CAGTGCAGACTGATGTGCTATGG + Intronic
1121721141 14:96109516-96109538 AAATGCAGACAGATGAGGTGTGG + Intergenic
1122508962 14:102250462-102250484 AGGTGCAGTCATATTAGGTAGGG - Intronic
1123117854 14:105902753-105902775 GGGTCCAGACAGCTGAGCCAGGG + Intergenic
1202921476 14_KI270723v1_random:33243-33265 AGGTGCAGACAGCTGGCCTTGGG - Intergenic
1202923437 14_KI270724v1_random:4337-4359 AGGTGCAGACAGCTGGCCTTGGG + Intergenic
1124778925 15:32611251-32611273 AGAGGCAGACAGATCACCTAAGG + Intergenic
1125289535 15:38130532-38130554 ACGGGCATACAGATGAGCTGAGG + Intergenic
1125316882 15:38441400-38441422 AGGTGGAGACAGAGCAGCTGGGG + Intergenic
1125336098 15:38627769-38627791 ATGTGCACACAGATAAGCTTGGG - Intergenic
1126249374 15:46549937-46549959 AAGTGCAGCCAGATAAGCAAAGG - Intergenic
1127340680 15:58040359-58040381 ACCTGCAGACAGATAATCTAGGG + Intronic
1127690157 15:61387435-61387457 ATGTACAGACAGCTGAGTTAAGG + Intergenic
1128323770 15:66709900-66709922 ATGTGCAGAAAGAGGATCTAGGG - Intronic
1128614286 15:69097213-69097235 TGGTGCAGTCAGGTGAGCTTGGG - Intergenic
1133519865 16:6546522-6546544 AGAAGCAGACAGAGGTGCTATGG - Intronic
1134655854 16:15948145-15948167 AGGTAGAGACAGAGGAGCTAGGG - Intergenic
1135848197 16:25938342-25938364 AGTTGCAGGCAGATGAGATTGGG + Intronic
1136625990 16:31462521-31462543 AGGTGCTGGTAGATGAGCTCCGG + Exonic
1137353189 16:47732572-47732594 ATGTGCAGACAAATGACCTGGGG + Intergenic
1137763354 16:50958597-50958619 AGGTTTCGACATATGAGCTATGG - Intergenic
1138880106 16:61002932-61002954 ATTTGCAAACACATGAGCTAAGG - Intergenic
1140631029 16:76852820-76852842 TGGTGCAGTCAGATGAAATAGGG + Intergenic
1141142952 16:81509255-81509277 AGGTGCAGAGAGATGTGGCATGG + Intronic
1141406973 16:83803131-83803153 AGGTGCTGAGAGATGAGACAGGG - Intergenic
1145976665 17:28987897-28987919 AGCAGTAGACAGCTGAGCTATGG - Intronic
1146141258 17:30369842-30369864 AGGAGCAGGCAGGTGACCTAAGG + Intergenic
1147178117 17:38669379-38669401 AGGTGCAAGCTGATGACCTAGGG + Intergenic
1147832427 17:43306185-43306207 AGGTCCAGACAGATTAGGGAGGG - Intergenic
1148349201 17:46927711-46927733 AGGTGCAGACAGACAAGGAAAGG - Intronic
1148556260 17:48580655-48580677 AGATGCAGCCAGATGATATAGGG + Intronic
1149045783 17:52243781-52243803 TGATGAAGACAGATGAGATAGGG - Intergenic
1150456543 17:65310998-65311020 GGCTGCAGAGAAATGAGCTAAGG + Intergenic
1150925680 17:69529290-69529312 AGGTTTAGACATATGATCTATGG + Intronic
1151100817 17:71553466-71553488 AGGGGCAGACAGGTGAACTGAGG + Intergenic
1151744094 17:76002208-76002230 AGGTGCAGCCAGCTGAGCGGAGG - Intronic
1151982939 17:77525035-77525057 AGGTACAGTGACATGAGCTATGG - Intergenic
1152893983 17:82899467-82899489 AGGTGCAGACACACGCGCTGCGG - Intronic
1153552545 18:6276494-6276516 AATTGCAAACATATGAGCTAAGG + Intronic
1153583438 18:6598164-6598186 AGGTGGAGAAAGATGAGGAAAGG + Intergenic
1154155469 18:11940910-11940932 AGGTGCAGCCACAGGAGCAAGGG + Intergenic
1157700022 18:49756382-49756404 AAGTGCAGACAGGCGAACTAAGG + Intergenic
1158091589 18:53720784-53720806 AGTTGCAGAGAAATGAGTTATGG + Intergenic
1160425501 18:78776270-78776292 AGCTGGAGACAGATGAGCTCAGG - Intergenic
1161488889 19:4550905-4550927 AGGCGCAGACAGCCGAGCCAGGG + Exonic
1161675711 19:5647372-5647394 AGGTGCAGAGAGATGGGATGGGG + Intronic
1161784812 19:6317690-6317712 AGTTGGAGAGAGATGAGTTATGG - Intronic
1164027182 19:21363470-21363492 AGCTACAGGCAGATGAGTTAAGG + Intronic
1165901986 19:39173417-39173439 AGGTGGGGACAGAGGAGCAACGG - Intronic
1166141725 19:40808765-40808787 AGGTGCAGGCAGAGGAGGAAGGG - Intronic
925132521 2:1503748-1503770 AGGAGCAGACAGATGTGCGCTGG - Intronic
926721544 2:15965135-15965157 AGGCCCAGACAGAGGAGCCAGGG + Intergenic
926918794 2:17918812-17918834 AGGTGTACACAAATGGGCTATGG + Intronic
929480539 2:42303313-42303335 AGGGTCATACAGATGAGCTTTGG + Exonic
932104575 2:68931106-68931128 AGGTGGAGACAGCTCAGCTGAGG - Intergenic
932848083 2:75155344-75155366 AGAGGCAGAAAGATGAGCCAAGG - Intronic
934681239 2:96285457-96285479 GAGTGCAGACAGAGGAGCTAAGG + Intronic
934979133 2:98825907-98825929 AGCTGGAGACAGTTGGGCTAGGG - Intronic
936846416 2:116840425-116840447 AAGTGGAGAGAGCTGAGCTATGG - Intergenic
937048894 2:118871981-118872003 AGGTGAAGAAAGAAGTGCTAGGG - Intergenic
937220619 2:120341308-120341330 TGGGGCAGACAGAGGAGCTGAGG - Intergenic
940363741 2:152822894-152822916 TGGAGCAGACATATGAGATAAGG - Intergenic
940794131 2:158058968-158058990 AGGTGAAGAGAGATGAGTGAAGG + Intronic
941568689 2:167142087-167142109 AGGTGCAGACTGATAAACCAGGG - Intronic
942023744 2:171893238-171893260 AGGTGCAGACAACTAAGCGAGGG - Exonic
942729173 2:179044714-179044736 AGGTGCATACAAAGGAGCTGGGG + Intronic
942801420 2:179880577-179880599 AGGTATAGACAGAGGGGCTATGG + Intergenic
943835898 2:192513550-192513572 AGGAGCAGACAGATGATGTTTGG + Intergenic
946188355 2:217994356-217994378 AGGTGCAGAGAGAGGACCTGGGG + Intronic
946394441 2:219436045-219436067 TGGTGCAAACAGGTGAGGTATGG + Intronic
948699848 2:239752690-239752712 AGGTGCAGCCACATGTGCTCAGG - Intergenic
1169550672 20:6698232-6698254 AGGTGGAGACAGAAGAGGCAGGG - Intergenic
1170015336 20:11775111-11775133 AGGTGCTCACAGATAAGCAAAGG + Intergenic
1170809326 20:19661433-19661455 GGGTGCAGACGGCTTAGCTAAGG - Intronic
1171344845 20:24458435-24458457 AGGAGCATACAGAAGAGGTATGG + Intergenic
1172717118 20:36972919-36972941 AGAGGCAGGCAGATCAGCTAAGG + Intergenic
1176150081 20:63586253-63586275 AGGAGCTGACAGATGACCTGTGG + Intergenic
1176216811 20:63951898-63951920 AGGGGCAGACAGGTCAGCCATGG + Intronic
1176994351 21:15537303-15537325 AGGTGCACAAAGATGAGGCAAGG + Intergenic
1178107425 21:29335701-29335723 AGGTATAGACAGATGATCTGAGG - Intronic
1178723272 21:35028948-35028970 CACTGCAGACAGATGAGCTAGGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179333501 21:40428127-40428149 GGGTTAAGACAGATGAGCTTTGG - Intronic
1180061062 21:45385343-45385365 AGGTGCACACAGGGGAGCTGAGG - Intergenic
1184955797 22:47885216-47885238 AGGTGCACACAGAGAAGCAAAGG - Intergenic
1185047320 22:48534939-48534961 AGGAGAGGACAGAGGAGCTAAGG - Intronic
949385704 3:3500037-3500059 ATGTGGAGACAGATGAGCAAAGG + Intergenic
950686440 3:14621857-14621879 AGGTGCAGGCAGATGAGGTTTGG - Intergenic
950778392 3:15370290-15370312 ATGTGCATACAGATCATCTAGGG + Intergenic
951948550 3:28171414-28171436 AGAGGCAGAAAGAAGAGCTACGG + Intergenic
953289689 3:41649201-41649223 AGGCGCAGACAGAATAGGTATGG + Intronic
953962192 3:47274684-47274706 AGGTGAAGACAGAGGAACTAAGG - Intronic
953996272 3:47522437-47522459 GGCTCCAGAGAGATGAGCTAAGG - Intergenic
954665268 3:52248161-52248183 TGGTGCGGAGAGATGAGATACGG + Exonic
957842485 3:85689573-85689595 AGGTGCAGAAAGACAAGTTAGGG + Intronic
961641697 3:128368803-128368825 CGGTGCAGGCAGATGAGGGAAGG - Intronic
968517912 4:1022610-1022632 AGGTGCAGCCAGCTGAGGTGGGG - Intronic
969618324 4:8266464-8266486 AGGTACAGAAAGCCGAGCTAGGG - Intergenic
970752264 4:19378037-19378059 GGTTGAAGACAGAGGAGCTAGGG - Intergenic
975523152 4:75321672-75321694 AGGTGCAGAAAGAAGATTTATGG - Intergenic
975957263 4:79856386-79856408 AGGTGCAATCAGATGAGCACTGG - Intergenic
976346889 4:84013978-84014000 AGCTGTACACAGATGAGTTAAGG + Intergenic
976473078 4:85452244-85452266 GGATGCAGACAGCTGAGCAAAGG + Intergenic
976484167 4:85581331-85581353 AGGTTCACAAAGATGAGTTAAGG - Intronic
978375382 4:108069722-108069744 AGAAGCAGACAGATCAGCTGAGG + Intronic
979472973 4:121123177-121123199 AGGAGCAAACAGATAAGCAAGGG + Intergenic
981309236 4:143280114-143280136 AGGAACAGACAAATGAGTTATGG + Intergenic
983517636 4:168674374-168674396 ACCTCCAGACAGATCAGCTAGGG + Intronic
983677080 4:170308270-170308292 AGGTGAAGAGAGATGAGCAAAGG - Intergenic
984194862 4:176646980-176647002 AGGTTCACACAGATGATATAGGG + Intergenic
985450877 4:190061491-190061513 AGGTGCAGACAGCTGGCCTTGGG - Intergenic
985829957 5:2220917-2220939 AGGTGAAGACACTTGAGCTGGGG - Intergenic
987019966 5:13860163-13860185 AGGGGAAGACAGATTAACTATGG - Intronic
990368281 5:55091854-55091876 ACGTGCAAACAAATGAACTAGGG - Intergenic
990612122 5:57468264-57468286 AGTTGCAGAAAAATGAGCTCAGG - Intergenic
992397114 5:76378397-76378419 AGGTGGAGACAGTTGAGAAAAGG + Intergenic
994379261 5:99051960-99051982 AACTGCAGACAGAGGACCTAAGG + Intergenic
996952186 5:129140683-129140705 AGGTGAAGAAAGATAAGCTGGGG - Intergenic
997908552 5:137844977-137844999 AGGGGCAGACAGAAGAGGTGAGG + Intergenic
998846490 5:146315424-146315446 TGGTGCAGACAAATAAGCCAAGG - Intronic
1000627405 5:163554955-163554977 TGATGCAGAAAGATGAACTAGGG - Intergenic
1003092375 6:3114929-3114951 AGGTGCAGACAGGAGAGCCGAGG - Exonic
1006470462 6:34225949-34225971 TGTTGCAGACAGGTGAGATAAGG - Intergenic
1008258981 6:49341930-49341952 AGGTGGAGATAGTTGAACTATGG + Intergenic
1008842631 6:55921992-55922014 AGGAGCATACAGAAGAACTAGGG + Intergenic
1008972381 6:57384607-57384629 AGGGGCAGACACATGATCTTAGG - Intronic
1009543413 6:64995118-64995140 AGCTGGAGACTGATTAGCTAAGG + Intronic
1015611900 6:135031501-135031523 AGGTGAAGAGAGATGAACCAAGG + Intronic
1017198827 6:151730424-151730446 ACATGGAGACAGATGAGCTCTGG - Intronic
1018081202 6:160260649-160260671 AGGTGCAGACAGAGCAGCCTTGG - Intronic
1019611419 7:1938703-1938725 AGGTGCACACACATGGGCCAGGG + Intronic
1022143003 7:27509418-27509440 TGGAGCAGACACAGGAGCTAGGG + Intergenic
1022930317 7:35105084-35105106 TGGAGCAGGCAGAGGAGCTAGGG + Intergenic
1023608237 7:41948698-41948720 AGGTGGAGTCAGATGAGCACAGG - Intergenic
1026689284 7:72538259-72538281 AGACCCAGACAGAGGAGCTAAGG + Intergenic
1029019897 7:97353679-97353701 AAGTTATGACAGATGAGCTACGG + Intergenic
1030375159 7:108745642-108745664 AGGTGCATTCAGATCAGCTCAGG - Intergenic
1031267001 7:119593618-119593640 AGGGGCAGACAGCTTAGTTAGGG - Intergenic
1032772789 7:135076199-135076221 AGGAGAAGACAGACTAGCTAGGG - Intronic
1033992788 7:147308496-147308518 ACTTGCAGACAGGTGAGATATGG + Intronic
1035607435 8:939067-939089 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607447 8:939104-939126 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607459 8:939141-939163 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607483 8:939217-939239 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607506 8:939293-939315 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607628 8:939671-939693 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607654 8:939747-939769 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607666 8:939784-939806 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607678 8:939821-939843 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035607690 8:939858-939880 AGGTGCAGACACAGGGGCTGGGG + Intergenic
1035980255 8:4362339-4362361 GGGGGCAGACAGATGAGCTTGGG - Intronic
1036435455 8:8729087-8729109 AGGTGCACACAAATGATCTGGGG + Intergenic
1039443957 8:37615317-37615339 AGGAGCAGAAAGAGGAGGTAAGG + Intergenic
1039800138 8:40947142-40947164 AGGAACAAACAGATGAGCTATGG + Intergenic
1043982013 8:86654042-86654064 AGGTGGATTCAAATGAGCTAAGG - Exonic
1045343859 8:101277122-101277144 AACTGCAGGCAGATGAGTTAAGG - Intergenic
1047187451 8:122646729-122646751 AGGTGCAGAGAGAAAAGCGATGG - Intergenic
1048553088 8:135452125-135452147 AGGTGGGGACAGACGAGCCAAGG - Intergenic
1050485743 9:6132959-6132981 TGGTGCAGGCAGAGGAGCAAGGG - Intergenic
1051900232 9:22030537-22030559 AGGTGGAAAAAGATGAGGTATGG + Intronic
1052487552 9:29121171-29121193 TGATGCACACAGATGAGCTGAGG + Intergenic
1053334114 9:37248785-37248807 AGCTACAGATAGATGAGCAATGG - Intronic
1055036128 9:71820485-71820507 AGCTGCAGAAAGATGGGCTAAGG + Intergenic
1055420627 9:76137264-76137286 AGGTGCTCACTGATGAGCTAGGG + Intronic
1055505041 9:76939611-76939633 AGGTGAAGTCAGCTGAGCTAGGG - Intergenic
1058888393 9:109340584-109340606 AGCTGCAGGCAGAAGAGGTAGGG - Intergenic
1062003652 9:134228887-134228909 AGGTGCAGAGGGAGGAGCTCAGG + Intergenic
1062268424 9:135697985-135698007 ACGTGCAGAGAAATGATCTAGGG + Intronic
1186148663 X:6650896-6650918 AGAGGAAGACAGATGAGCAAGGG + Intergenic
1190081791 X:47362414-47362436 AGGTCCAGCCAGATGAGCAGTGG - Intergenic
1194503187 X:94703544-94703566 AGGTGCAGAGATATGAGGTTGGG + Intergenic
1199918117 X:152366838-152366860 AGGAGCAGACTGAAGTGCTATGG + Intronic
1200717413 Y:6564607-6564629 AGATGAAGAGAGATTAGCTACGG + Intergenic
1201509638 Y:14744794-14744816 AGAAACAGACAGATGAGTTAGGG - Intronic