ID: 1104916511

View in Genome Browser
Species Human (GRCh38)
Location 12:132267620-132267642
Sequence TTAGTACCACAGCCATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104916509_1104916511 -4 Left 1104916509 12:132267601-132267623 CCTCAAGTTAAGACTGATTTTAG 0: 1
1: 0
2: 1
3: 17
4: 140
Right 1104916511 12:132267620-132267642 TTAGTACCACAGCCATTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 69
1104916508_1104916511 -1 Left 1104916508 12:132267598-132267620 CCACCTCAAGTTAAGACTGATTT 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1104916511 12:132267620-132267642 TTAGTACCACAGCCATTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 69
1104916507_1104916511 18 Left 1104916507 12:132267579-132267601 CCAAGCGGGAGGACTCACACCAC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1104916511 12:132267620-132267642 TTAGTACCACAGCCATTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104916511 Original CRISPR TTAGTACCACAGCCATTGGC AGG Intronic
904670784 1:32163392-32163414 TCAGGACCACAGCCCTTTGCAGG - Intronic
906062722 1:42958897-42958919 ATAGGACCCCGGCCATTGGCTGG + Intergenic
906448089 1:45921288-45921310 TTAAGACCACAGACATAGGCTGG - Intronic
909764361 1:79337047-79337069 TAAGGACCATTGCCATTGGCTGG + Intergenic
916884249 1:169051802-169051824 TTTGTTCCACAGACATTGGATGG - Intergenic
1065464437 10:26004048-26004070 TTAGAACAAAAGCCATTGGGTGG + Intronic
1069628755 10:69884296-69884318 TTTATACCACAGACATTGGCAGG + Intronic
1071351996 10:84755797-84755819 TTAGTTCCACAGCCCTGGACAGG + Intergenic
1074314837 10:112351708-112351730 TTACTACCAGAGCCATTGAGTGG + Intergenic
1078446842 11:11410990-11411012 TGGGTGCCACAGCCCTTGGCAGG + Intronic
1078686406 11:13536427-13536449 TTTGTACCACAGCCTTGGCCAGG + Intergenic
1079036436 11:17024302-17024324 TTAGTCCAAGAGCCATTGGAGGG - Intergenic
1085468994 11:76744765-76744787 TTAGTCCAACAGCCATTCCCTGG - Intergenic
1086275749 11:85126691-85126713 TTAGAACCAGTGTCATTGGCAGG + Intronic
1086406609 11:86504277-86504299 TTAGAACCACAGCTCTGGGCTGG + Intronic
1093512920 12:19949977-19949999 TTAGTACCACTCCCATTTGAGGG - Intergenic
1096529930 12:52236118-52236140 TTAGTCACACAGCCACAGGCAGG - Intronic
1104916511 12:132267620-132267642 TTAGTACCACAGCCATTGGCAGG + Intronic
1109396619 13:61766762-61766784 TTGGGTCCACAGCCATTGCCTGG + Intergenic
1125201146 15:37101545-37101567 TAATTAACACAGCCATTAGCAGG - Intergenic
1129205058 15:74032628-74032650 ACTGTACCACAGCCATAGGCTGG - Exonic
1130138083 15:81198200-81198222 TTAGTACCCCAACCATTTCCTGG + Intronic
1133735355 16:8610872-8610894 TTAGAACAACAGGAATTGGCTGG - Intergenic
1148162829 17:45461181-45461203 TTAAAACAACAGACATTGGCTGG - Intronic
1150394059 17:64807833-64807855 TTAAAACAACAGACATTGGCTGG - Intergenic
1166296342 19:41891913-41891935 TGAGTCCCACAGCCATAGGATGG + Intronic
1167805291 19:51779013-51779035 GTGGTAACACAGCCATTGGGAGG + Intronic
925040607 2:731023-731045 TTAATAGCACCGCCATTGGCAGG + Intergenic
927497958 2:23563328-23563350 TTCCTACCACAGCCATGGCCAGG - Intronic
928879961 2:36086905-36086927 TCAGTACCAAAGCCATTGGTTGG - Intergenic
933331378 2:80896772-80896794 TAAGTCCCTCAGCCACTGGCTGG - Intergenic
937471952 2:122181697-122181719 TTAGGACTAGAGGCATTGGCTGG + Intergenic
938681317 2:133693917-133693939 TTAGAGCCACAGCAATTGGTAGG - Intergenic
942488357 2:176463625-176463647 TTTATACCACAGAAATTGGCAGG + Intergenic
945319188 2:208401986-208402008 TTTGTATCACAGCCATTTGGTGG + Intronic
946652293 2:221906421-221906443 TTCGTATCCCAGTCATTGGCTGG + Intergenic
946956064 2:224931266-224931288 TTAGAAACCCAGACATTGGCAGG + Intronic
948959955 2:241326762-241326784 TCACTTACACAGCCATTGGCAGG - Intronic
1168834333 20:867876-867898 TTAAAAACACAGTCATTGGCCGG - Intergenic
1173194284 20:40901221-40901243 TTACAACAACAACCATTGGCTGG - Intergenic
1183723770 22:39577330-39577352 TTAGAAGCACAGACATTGGCTGG - Intronic
955456153 3:59124042-59124064 TTTGTACCACAGCCATTCTTTGG + Intergenic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
959143138 3:102510400-102510422 TTACCACCACAGCCATTTGGGGG + Intergenic
960674552 3:120181734-120181756 GTGCTACCACAGCCATTGTCTGG + Intronic
960965071 3:123098881-123098903 CTAGAACCTCAGTCATTGGCTGG + Intronic
971610811 4:28723865-28723887 TTAGTTCTCCAGTCATTGGCAGG + Intergenic
974920697 4:68235555-68235577 TTTGTTCCACAGCCATTGTAAGG + Intronic
986340602 5:6786044-6786066 TTAAGACCACAGCAAGTGGCAGG - Intergenic
992131389 5:73696202-73696224 TAATGACCACAGCCATTGCCTGG - Intronic
993856910 5:93087607-93087629 TTTGTACCACAGGCCTGGGCTGG - Intergenic
997008781 5:129851579-129851601 TTAGTGCCACAGTCATTTTCAGG + Intergenic
997851019 5:137332530-137332552 TGATTACCACAGCGACTGGCTGG + Intronic
998822103 5:146066550-146066572 TTAGCACCACAGTCCTGGGCAGG - Intronic
999914936 5:156248223-156248245 TTAAAACCAAGGCCATTGGCTGG + Intronic
1002760728 6:199979-200001 TTAGGACCACTGCCTTTGCCTGG + Intergenic
1003020039 6:2502030-2502052 TTAGTACCCCAGCCATGGGGAGG + Intergenic
1003482729 6:6547745-6547767 TTACTACCGCAGCCTGTGGCTGG + Intergenic
1007221468 6:40282280-40282302 TGAGAACCACAGCCCTAGGCTGG + Intergenic
1012073803 6:94657825-94657847 ATAGGACCACTGCCATTGGTAGG + Intergenic
1014583802 6:123172035-123172057 TTAGAACCACTGCCATTGGAAGG + Intergenic
1014830444 6:126096975-126096997 TTATAACCACAGTCAATGGCTGG + Intergenic
1017458058 6:154620780-154620802 TTAATACAAGAGCAATTGGCAGG + Intergenic
1018224513 6:161615595-161615617 TTGCTGCCACAGCCTTTGGCTGG - Intronic
1026834133 7:73626966-73626988 TTCCTCCCACAGCCAGTGGCTGG - Intergenic
1031761509 7:125718123-125718145 TTAGTTGCACACTCATTGGCTGG - Intergenic
1037975303 8:23206010-23206032 ATAGAAACACAGACATTGGCCGG - Intronic
1054751860 9:68915551-68915573 TGAGTACCAGACCCTTTGGCTGG - Intronic
1056752160 9:89359881-89359903 TTTTCACCACAGCCAATGGCAGG + Intergenic
1060409433 9:123390330-123390352 TTTGTACCACAGCCACAGTCTGG - Intronic
1189489355 X:41457590-41457612 TTTGTACCAAAGCCATGTGCAGG - Intronic
1190731786 X:53231414-53231436 TTAGGACCACAGAGATTGGCTGG + Intergenic
1190736985 X:53262241-53262263 TTAGTGCCCCTGCCATGGGCAGG - Intronic
1199654685 X:149982637-149982659 TTAGTACCTCAAGCATTGGTAGG + Intergenic
1199920578 X:152398428-152398450 TAAGAACCACAGCCAAAGGCTGG - Intronic
1200078760 X:153565280-153565302 TCAGTGCCACAGCCATCAGCGGG - Intronic
1201369442 Y:13245777-13245799 TTAGTAACAGAGCTATTGACTGG - Intergenic