ID: 1104919666

View in Genome Browser
Species Human (GRCh38)
Location 12:132283917-132283939
Sequence GACCCCCGAGACCACCTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104919666_1104919667 -1 Left 1104919666 12:132283917-132283939 CCGTCAAGGTGGTCTCGGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1104919667 12:132283939-132283961 CTTCCTGCCACACAGCTGCCTGG 0: 1
1: 0
2: 2
3: 43
4: 383
1104919666_1104919669 2 Left 1104919666 12:132283917-132283939 CCGTCAAGGTGGTCTCGGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1104919669 12:132283942-132283964 CCTGCCACACAGCTGCCTGGAGG 0: 1
1: 0
2: 3
3: 48
4: 389
1104919666_1104919672 19 Left 1104919666 12:132283917-132283939 CCGTCAAGGTGGTCTCGGGGGTC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1104919672 12:132283959-132283981 TGGAGGCTCACAGCCAAGAACGG 0: 1
1: 0
2: 1
3: 22
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104919666 Original CRISPR GACCCCCGAGACCACCTTGA CGG (reversed) Intronic
901028412 1:6291689-6291711 GGCCCTCGAGACCTCCTTCATGG + Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
903837841 1:26217356-26217378 GAGCCCCGGCACCCCCTTGAAGG - Intergenic
904968466 1:34399752-34399774 GACCCCTCAGGCCACCCTGAAGG - Intergenic
907745684 1:57211298-57211320 GACCCCAAGGACCATCTTGAGGG + Intronic
915074419 1:153296908-153296930 GTCCCCCAAGAGCACCCTGAAGG - Intergenic
915339532 1:155168748-155168770 AACCTCTGAGCCCACCTTGATGG - Intergenic
1070032825 10:72692962-72692984 GACCCCCAAAAGCACCTTTAAGG - Intronic
1072528249 10:96294062-96294084 GTACCCGGATACCACCTTGAAGG - Intergenic
1076032971 10:127175250-127175272 GACCCCCAAGAGCACTTTGATGG + Exonic
1076415249 10:130282207-130282229 GGCTCCCGAGGCCACCTTGGGGG + Intergenic
1076479475 10:130775466-130775488 GCCACCCGAGGCCACCTTCATGG + Intergenic
1076530336 10:131140660-131140682 GACCCCAGAGAGCACCTTGCAGG + Intronic
1077154266 11:1084418-1084440 GTGCCCTGAGTCCACCTTGATGG - Intergenic
1077746445 11:4912019-4912041 GATCCCAGAAACCACCCTGAGGG - Intronic
1084118795 11:67056952-67056974 GCCCACCAGGACCACCTTGACGG - Exonic
1084387617 11:68854261-68854283 GACCTCCGAGTGGACCTTGAAGG - Intergenic
1102035984 12:109770803-109770825 CCCCGCCGAGACCACCATGAAGG - Intergenic
1102871300 12:116416296-116416318 GACCCCTGAGGTCACCTTGGCGG - Intergenic
1103022721 12:117549063-117549085 GCCACGCAAGACCACCTTGAAGG + Intronic
1104919666 12:132283917-132283939 GACCCCCGAGACCACCTTGACGG - Intronic
1107056629 13:36111902-36111924 CACTCCCGAGTCCAGCTTGATGG + Exonic
1107448820 13:40490535-40490557 GAGCCCCAAGACAACTTTGATGG - Intergenic
1110774594 13:79393708-79393730 GACCACTGAGATCACCTTGTGGG + Intronic
1113781045 13:112977711-112977733 GACCCCAGAGGCGACCCTGATGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118682396 14:68256341-68256363 GACACCCGAATCCACCTGGAAGG - Intronic
1120020554 14:79525237-79525259 GAGCCCCAACACCACCTCGAGGG + Intronic
1122886680 14:104713388-104713410 GACCCTGGAGCCCACCTAGAGGG - Intronic
1123032105 14:105456820-105456842 GACCCCCCAGCCCGCCTTGCTGG + Intronic
1129230397 15:74194013-74194035 GGCCCCCCAGACCACCCTCAGGG - Intronic
1130094020 15:80842889-80842911 GACCCCTGGGACCTCCTGGAAGG - Intronic
1130994235 15:88895207-88895229 GACCCTCGTGCCCACCGTGAGGG - Intronic
1132596499 16:753295-753317 GAACCCCGAGAACACTTTGCCGG - Intronic
1132727420 16:1345018-1345040 GAGCCCCGAGGCCACCTCCAGGG - Exonic
1132885156 16:2179231-2179253 CAGCCCCGCGACCGCCTTGACGG + Exonic
1137405951 16:48189684-48189706 AAACTCAGAGACCACCTTGAGGG + Intronic
1137588111 16:49676569-49676591 GTCCACCGAGACCACCTTGCAGG + Intronic
1138533460 16:57647317-57647339 CACCCACCAGAGCACCTTGAGGG - Intronic
1142315232 16:89339947-89339969 GACCCCAGAGCACAACTTGAAGG - Intronic
1142354420 16:89595624-89595646 GACCCCCAAGCCGGCCTTGACGG - Intronic
1143615875 17:8048828-8048850 GCCCGCAGAGCCCACCTTGAGGG + Exonic
1145231013 17:21173147-21173169 GACGACCGTGACCTCCTTGAAGG - Intronic
1148221381 17:45864838-45864860 GAACCCCCAGACCAGCTTGCAGG + Intergenic
1150480219 17:65503643-65503665 GACCTCCGAGCCCACCCAGAGGG + Intergenic
1151898237 17:76994820-76994842 CACACCAGAGGCCACCTTGAGGG + Intergenic
1160491126 18:79337319-79337341 GACTACCGCGGCCACCTTGAGGG - Exonic
1160853586 19:1206149-1206171 GGCCCCGGCGACCACCTTGGGGG + Intronic
1161048399 19:2149566-2149588 CACCACCAAGACCCCCTTGAAGG + Intronic
1161975931 19:7607747-7607769 GGCCCCCAAGCCCACCTTGGGGG - Intronic
1163612497 19:18308681-18308703 GACCCCTGACCCCACCTTCACGG - Intronic
1163830360 19:19544597-19544619 GAACCCCGAGACCGGCTTGTGGG + Exonic
1167881525 19:52462726-52462748 AACCCCCAAGCACACCTTGATGG - Intronic
1168301495 19:55407544-55407566 GACACCCCCGACCACCTTCATGG + Intronic
925262844 2:2543073-2543095 GACCCCAGAGCTCTCCTTGAAGG + Intergenic
925893839 2:8456798-8456820 GCCCACCGAGAGCACCTGGAAGG + Intergenic
926336522 2:11866679-11866701 GACCCCAGAGACCACCACTAAGG + Intergenic
926592772 2:14757521-14757543 GACCGCCGTGACCACGGTGAGGG - Intergenic
932651196 2:73559440-73559462 GTCCCCAGAGACAACCTTAAAGG + Intronic
1170016741 20:11790272-11790294 GACCACAGAGACCACATGGAAGG + Intergenic
1172663384 20:36582759-36582781 GACCACCCAGCCCTCCTTGATGG + Intronic
1173732059 20:45335877-45335899 GACCCCCAGGACCTCCTAGAAGG - Exonic
1175940410 20:62535176-62535198 GACACCCTGGACCCCCTTGAGGG + Intergenic
1176236592 20:64056438-64056460 GACCCTCCAGCCCACCTTGGGGG - Intronic
1176299132 21:5090352-5090374 GACCCCCAAGCCCACCTGGCTGG - Intergenic
1179857894 21:44171596-44171618 GACCCCCAAGCCCACCTGGCTGG + Intergenic
1180045429 21:45302951-45302973 GCCTCCCAAGACCACCGTGAGGG - Intergenic
1180154894 21:45972964-45972986 GCCCCCAGAGCCCACCCTGAAGG - Intergenic
1181147529 22:20859189-20859211 GACGCCCGAGACCTCCCCGACGG + Exonic
1184241021 22:43211319-43211341 GACCACACAGGCCACCTTGATGG + Intronic
1184845111 22:47078118-47078140 GTCCCCCTAGACACCCTTGAGGG + Intronic
954387109 3:50249832-50249854 TACGCCAGAGACCACCCTGAGGG - Intronic
954541051 3:51393071-51393093 GACCGCCGAAACAGCCTTGAGGG + Exonic
956248539 3:67211551-67211573 GACCTCCTAGACCATCTTGATGG - Intergenic
972249450 4:37284469-37284491 GACCCCACAGCCCATCTTGAGGG + Intronic
982244546 4:153337897-153337919 GACCCCCCAGCCCCCCTTGCTGG + Exonic
988517676 5:31918750-31918772 GACCCCCAAGATCTCATTGATGG + Intronic
1005354182 6:24966930-24966952 AGCTCCTGAGACCACCTTGAAGG - Intronic
1007506602 6:42340302-42340324 TACCCCCAAGACTACCTTGGAGG + Intronic
1026928709 7:74210949-74210971 GACGCTCGAGACCACCCTGCCGG - Intronic
1031020325 7:116620695-116620717 GAACCCAGAGGCCAGCTTGATGG + Intergenic
1034201102 7:149283497-149283519 GACCCCAGAAAGCACCCTGAGGG + Exonic
1034969722 7:155411353-155411375 GACCCCCCAGATGACCTGGAGGG - Intergenic
1043010582 8:74877604-74877626 GACCCCCCACACCACCCGGATGG + Intergenic
1044611284 8:94094799-94094821 GAACCCTGACACCACCCTGATGG + Intergenic
1047652680 8:126940471-126940493 TACCCCTGAGGCCACCCTGAAGG + Intergenic
1047913269 8:129554320-129554342 GACCCCAGAGACCCCATTGTGGG + Intergenic
1049466390 8:142752892-142752914 GACCCCCCAGACTGCCTGGAAGG + Intergenic
1057717711 9:97508106-97508128 GACTCTGGAGACCACCTTGCTGG + Intronic
1062040301 9:134401499-134401521 GACCCACGGGGCCACCTTGAGGG + Intronic
1187135017 X:16539591-16539613 GAATCCCAAGACCACCTAGAAGG + Intergenic
1195266314 X:103183553-103183575 TACCACAGAGACCACCTGGAAGG + Intergenic
1196862271 X:120039544-120039566 GACCCAAGAGACCACCAGGAGGG + Intergenic
1196880831 X:120196800-120196822 GACCCAAGAGACCACCAGGAGGG - Intergenic