ID: 1104919689

View in Genome Browser
Species Human (GRCh38)
Location 12:132284184-132284206
Sequence ACGTGTGCACACACATGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104919689 Original CRISPR ACGTGTGCACACACATGCGT GGG (reversed) Intronic
900177383 1:1296885-1296907 ACGTGTGCACACCCTCACGTGGG + Intronic
900285612 1:1898599-1898621 GCATGTGCACACACATGAGTTGG + Intergenic
900285622 1:1898789-1898811 ATGTATGCACACACATGAGCTGG + Intergenic
900580947 1:3408739-3408761 ACGTGTGCCAACACATGCACCGG - Intronic
900896640 1:5487329-5487351 AGGGGTGCACACACATTCCTAGG - Intergenic
900898115 1:5497990-5498012 ACATCTGCACACTCATGCATGGG - Intergenic
901190387 1:7406554-7406576 AGGTGTACACACACATGCACAGG + Intronic
901470748 1:9454746-9454768 ACATGTGCACACACGTTCATAGG + Intergenic
901804620 1:11730391-11730413 GCGTGTGCACGCACATGTGCAGG - Intergenic
902362618 1:15950452-15950474 ACGTGAGCACACAGGTGTGTGGG + Intronic
902516187 1:16990862-16990884 ATATGTGCACACACATTCATGGG - Intronic
902689828 1:18103840-18103862 ACGTGTCCACACACATATATAGG - Intergenic
903270108 1:22182898-22182920 ACATGTGCACAGACATGCACTGG - Intergenic
905638925 1:39575727-39575749 AGCTGTGCCCACACGTGCGTGGG - Intronic
906155852 1:43613529-43613551 ACATGTGCACATACATGCGTTGG + Intronic
906694643 1:47815750-47815772 ATGTGTGTGCACACATGTGTGGG + Intronic
908369275 1:63465204-63465226 ACATGTGCACACACATACATAGG - Intronic
908481085 1:64540161-64540183 ACGAATGCACACAAATGCTTAGG - Intronic
910214094 1:84824793-84824815 TTGTGTGCGCACACATGTGTGGG - Intronic
910935310 1:92481903-92481925 CCGTATGCACTCACATGCGTTGG - Intronic
913247476 1:116882856-116882878 TTGTGTGCACACACCTGTGTTGG - Intergenic
915525816 1:156475670-156475692 GCGTATGCACACACGTGTGTGGG + Intronic
916803754 1:168238955-168238977 ACACGTGCATGCACATGCGTGGG + Intronic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
923247389 1:232145695-232145717 AGGGGTGAACACACATGCGCAGG - Intergenic
923337394 1:232982341-232982363 AGATGTGCACACACATCCGCAGG - Exonic
1062794893 10:337333-337355 ACGCGCGCACACACCTGCCTAGG - Intronic
1064630054 10:17300772-17300794 ACGTGTTCTCACTCATGAGTGGG - Intergenic
1071088816 10:81895639-81895661 ACGTGTGCATGTCCATGCGTGGG + Intronic
1073426816 10:103459921-103459943 ATGTGGGCACACACATGGGGAGG - Intergenic
1075284857 10:121174669-121174691 GTATGTGCACACTCATGCGTGGG - Intergenic
1075416567 10:122268612-122268634 GTGTGTGCACAGCCATGCGTGGG + Intergenic
1076195913 10:128518080-128518102 ACTTGTGCACACACACTCCTGGG - Intergenic
1076365442 10:129918708-129918730 GCATGTGCACACAGATGTGTAGG - Intronic
1076767664 10:132645392-132645414 ATGTGTACACACACATGCTCCGG + Intronic
1077731190 11:4731706-4731728 ATGTGTGCATGCACATGTGTGGG + Intronic
1080625044 11:34021445-34021467 ATGTGTGTGCACACATGTGTAGG - Intergenic
1081044178 11:38250946-38250968 AAGTGTGCACACACCTGGCTGGG + Intergenic
1083144324 11:60747527-60747549 ACGTGTGCACACTCACCCATAGG + Intergenic
1084449979 11:69230930-69230952 ACGTGTCCACAAGCATGCATGGG - Intergenic
1084890393 11:72233933-72233955 ACGTATGCACACACACTCATGGG - Intronic
1085297697 11:75440150-75440172 ACGTGTGCACACACACGCCCCGG - Intronic
1087072355 11:94093674-94093696 ATGTGTGCATGCACATGCTTGGG - Intronic
1087543651 11:99554436-99554458 TCATGTGCACACACATACATGGG - Intronic
1091150217 11:133321479-133321501 ACATGTGCACACACAAGAGGAGG - Intronic
1094040284 12:26114524-26114546 ACGTGTGCCCGCACATGTCTGGG - Intergenic
1097721348 12:63024925-63024947 ATGTGTGTACATACATGCATGGG + Intergenic
1097915054 12:65012488-65012510 TCATGTGCAAACACATGCATAGG + Intergenic
1099698433 12:86053105-86053127 ACGTGGGCATTCACATGTGTAGG - Intronic
1099963942 12:89424969-89424991 ACGTGTGCACACAAATGCATAGG + Intronic
1104408569 12:128539314-128539336 ACCTTAGCACACACATGTGTGGG + Intronic
1104919689 12:132284184-132284206 ACGTGTGCACACACATGCGTGGG - Intronic
1108253726 13:48591128-48591150 AGGTGTGCACACACACTCATAGG - Intergenic
1108854477 13:54775748-54775770 AGGTGTGCACACACTTGGGGTGG - Intergenic
1109529222 13:63619237-63619259 ACGTGTGCACACACACACACAGG + Intergenic
1110363810 13:74659238-74659260 GGGTGTGCACACTCATGCTTAGG - Intergenic
1112827312 13:103406578-103406600 ATGTGTGTATACACATGGGTGGG - Intergenic
1113561032 13:111281643-111281665 ACGTGTACACACACGTCCCTGGG - Intronic
1115101101 14:29700947-29700969 ACGCGTACACACAAATGCCTTGG - Intronic
1117285540 14:54282800-54282822 AAGTGTGCACACACATGGCTGGG + Intergenic
1119683135 14:76607758-76607780 ACGTGTGCACACACATGTCAGGG + Intergenic
1121187070 14:91982917-91982939 ATGTGTGCACATGCATGTGTTGG - Intronic
1123966996 15:25469061-25469083 ACATGTCCACACACATGCCAGGG - Intergenic
1127538362 15:59912746-59912768 ACGTGTTCTCACTCATGGGTGGG + Intergenic
1128541154 15:68534285-68534307 ATGTGTGCACACATATGTGCAGG - Intergenic
1129608046 15:77034390-77034412 AGGAGTGCACACACATGCGCAGG - Intronic
1131656374 15:94463134-94463156 ACTTGTGCACACACAACTGTTGG + Intronic
1132808357 16:1786207-1786229 GCGTGTGCAAACACACACGTGGG - Intronic
1133285896 16:4690673-4690695 CCGAGTGCACACACATGCATGGG - Exonic
1133511080 16:6457971-6457993 GCGTGTGCACACACATACATAGG + Intronic
1138440045 16:57028805-57028827 ACATGTGCACACCTATGAGTGGG - Intronic
1138532884 16:57644490-57644512 ACATATGCACACTCATGCATGGG + Intronic
1138532902 16:57644774-57644796 ACATATGCACACTCATGCATGGG + Intronic
1138771245 16:59666407-59666429 CCTTGTGCACACAACTGCGTTGG - Intergenic
1139599460 16:67977878-67977900 AGGTGTACACACATATCCGTAGG + Intronic
1141421038 16:83915696-83915718 GCGGGTGCACACAAATGAGTGGG + Exonic
1141675442 16:85515066-85515088 ACGTGTGCACACACATCCATAGG - Intergenic
1142226373 16:88879711-88879733 AGCTTTGCACACACATGCCTGGG - Intronic
1142290103 16:89190189-89190211 TCGGGTGCCCACACTTGCGTTGG + Intronic
1143387617 17:6541327-6541349 GCTTGTGCACATACATGTGTGGG + Intronic
1145714849 17:27009815-27009837 ATGTGTGCACAGACATACATGGG - Intergenic
1146102224 17:29994192-29994214 ACACGTGCACACACACGCGGTGG + Intronic
1147511193 17:41070140-41070162 ACTTGTGCAGACACCTGCATGGG - Intergenic
1148739070 17:49881647-49881669 ACGTGTGCACATATATGTGTGGG + Intergenic
1152139225 17:78526475-78526497 ACGTGTGCGAGCACATGCATGGG - Intronic
1152575517 17:81139084-81139106 ACATGTGCACACACATCCCCTGG + Intronic
1154359572 18:13648043-13648065 AGGTGTGCCCACAGATGCGGAGG + Exonic
1161120727 19:2524770-2524792 GCGTGTGCGCACACGTGTGTGGG + Intronic
1162530395 19:11232693-11232715 ACTTGTGTCCACACATGCATGGG + Intronic
1163772062 19:19197254-19197276 GCGTGTCCACACACATGTGCTGG + Intronic
1165718331 19:38061555-38061577 ACGTGTGCACACAGATGGCCAGG - Intronic
925067386 2:938988-939010 CCATGTGCACACGCATGCATGGG + Intergenic
925369169 2:3331139-3331161 GCGTGTGCACACTCATGAGATGG + Intronic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
927350748 2:22110999-22111021 GTGTGTGCACACACATATGTGGG - Intergenic
927380435 2:22473439-22473461 ACGTGTGCACCACCATGCCTAGG + Intergenic
932363906 2:71134148-71134170 ACGAGTACACACACATGATTGGG - Intronic
932445074 2:71775608-71775630 ACGTTTCCAGACACATGGGTAGG + Intergenic
937018832 2:118632382-118632404 GCGTGTGCACACACATGGACTGG + Intergenic
937711126 2:124981302-124981324 ACGTGTGCACACACAAACATGGG - Intergenic
938723506 2:134086862-134086884 ATGAGTGCAGACACATTCGTAGG - Intergenic
939637815 2:144604123-144604145 ATGTGTGCATAAACATGCATGGG - Intergenic
940476816 2:154172516-154172538 ACGTGTTCTCACTCATGAGTAGG - Intronic
1169178747 20:3543186-3543208 ACGTATACACACACCTGTGTGGG + Intronic
1170889358 20:20365385-20365407 ACCTGTGCACCCGCATGCATGGG - Intergenic
1172273779 20:33668897-33668919 ACGTGTCCACACAAACGCGTGGG + Intronic
1173005422 20:39136383-39136405 ACATGTGCACATACATGCACAGG - Intergenic
1176021576 20:62964963-62964985 ACGTGTGCACACACGCATGTGGG - Intronic
1176289160 21:5035126-5035148 TTGTGGGCACACACATGAGTGGG - Intronic
1179333240 21:40426050-40426072 ACCTGTGAACACACATGGATTGG + Intronic
1179868075 21:44228478-44228500 TTGTGGGCACACACATGAGTGGG + Intronic
1181818360 22:25456800-25456822 ACGTGTGTGCACACATGTGTGGG + Intergenic
1182051007 22:27312779-27312801 ATGTGTACACACACATGCATAGG + Intergenic
1182066687 22:27436063-27436085 GTGTGTGTGCACACATGCGTGGG + Intergenic
1182305525 22:29365287-29365309 ATGTGTGGACAGACATGCCTGGG - Intronic
1182312801 22:29421226-29421248 ATGTGTGGACAGACATGCCTGGG - Intronic
1183008695 22:34926798-34926820 ACGTGTTCTCACTCATGAGTGGG + Intergenic
1183695780 22:39421352-39421374 CCATGTGCACACACATGTGTTGG + Intronic
1184127035 22:42494780-42494802 GCGTGCGCACACACATGCATAGG + Intergenic
1184241815 22:43214994-43215016 ACACGTGCACACACAGGCATGGG - Intronic
1185154699 22:49186336-49186358 GCATGTGCACTCACATGTGTGGG + Intergenic
952973074 3:38667617-38667639 ACGTGTTCTCACTCATGTGTAGG + Intergenic
953188118 3:40657178-40657200 TCATGTGCACATACATGCATAGG - Intergenic
957001660 3:74893515-74893537 AGGTGTGCACAGACATGGGAAGG + Intergenic
957876557 3:86154469-86154491 ACGTGCACACACACACACGTGGG - Intergenic
961931130 3:130533922-130533944 GCGTGCACACACACATACGTGGG - Intergenic
962669763 3:137693148-137693170 ACGTGTGTACACACCTGTGGTGG + Intergenic
965519425 3:169658454-169658476 GGGTGTGCACACGCATGTGTGGG + Intronic
967872890 3:194246844-194246866 ACATATGCACACACACGAGTGGG - Intergenic
969266003 4:6064500-6064522 CCGTGTGTGCACACATGCGTGGG + Intronic
969705840 4:8790862-8790884 ACAGGTGCACACACATACGCAGG + Intergenic
973634617 4:52850566-52850588 ACATATGCACACACATTCTTCGG + Intergenic
974697877 4:65398255-65398277 AAGTGTGCACACATCTGCCTGGG - Intronic
975898276 4:79120961-79120983 ACGTGTTCTCACTCATGGGTGGG + Intergenic
976800700 4:88988227-88988249 ATGTGTGCACACCCATGTGCAGG - Intronic
978708536 4:111747844-111747866 ATGTGTGCATACACATGTATTGG + Intergenic
985053071 4:186012238-186012260 GTGTGTGCACACACACGCATAGG + Intergenic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
985986367 5:3520066-3520088 ACATGCACACACACATGCATGGG + Intergenic
986522560 5:8636297-8636319 ACATGTGCATACACATGCATAGG - Intergenic
986923000 5:12710568-12710590 ACATGTACACACACATGCATGGG - Intergenic
987087837 5:14486826-14486848 ACGCTTGCTCACACATGCCTGGG + Intronic
987206621 5:15634209-15634231 TTGTGTGCACACACCTGTGTGGG + Intronic
988491992 5:31712746-31712768 ACGTGTGCACAGAAAAGCGCAGG + Intronic
993811436 5:92482874-92482896 GCGTGTGCACACACACACGCAGG + Intergenic
997400827 5:133600671-133600693 ATATGTGCACACACACGCGTTGG + Intronic
998267507 5:140677200-140677222 ATATGTACACACACATGCATGGG - Intronic
1000981944 5:167825573-167825595 GCGTGCACACACACATGCATAGG + Intronic
1002803390 6:548662-548684 ACGCGTGCACACACAGCCGCTGG - Intronic
1005536482 6:26761809-26761831 ATCTGTGCACACACATGTGAAGG - Intergenic
1006524175 6:34589595-34589617 ACATGTGCACACACGGGTGTTGG - Exonic
1007810816 6:44484584-44484606 CCATGTGCACACACATGCCCTGG + Intergenic
1007836571 6:44678553-44678575 ACGTGTGCACACACACTCCAGGG + Intergenic
1010002565 6:70962480-70962502 TTGTGTGCACACGCATGCATGGG + Intergenic
1010567034 6:77428716-77428738 GTGTGTGCACACGCATGTGTGGG + Intergenic
1012800894 6:103826378-103826400 ACATGTTCTCACACATGTGTTGG + Intergenic
1019576908 7:1742008-1742030 ACGTGTACAAACACGTGTGTGGG + Intronic
1019601837 7:1888379-1888401 ACGCATGCACACACACGCATAGG - Intronic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1023315750 7:38934601-38934623 ACGCGTGCACACACACACGGTGG + Intergenic
1027052093 7:75027044-75027066 ACGTGTGCACACACAGCGGGGGG - Intergenic
1034491048 7:151393285-151393307 CTGTGTGCACACACAGGCATAGG - Intronic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035389085 7:158493419-158493441 ACGTATGCACACACGTACATGGG + Intronic
1035389093 7:158493575-158493597 ACGTATGCACACACGTACATGGG + Intronic
1035389101 7:158493731-158493753 ACGTATGCACACACGTACATGGG + Intronic
1035432439 7:158832142-158832164 ATGTGTGTGCACACATGTGTAGG + Intergenic
1035564786 8:634503-634525 ACGTCTGCACACCCATGCTCAGG + Intronic
1035628544 8:1091530-1091552 GTGTGTGCACACACATAGGTGGG - Intergenic
1039625374 8:39045297-39045319 AGGTGTACACACACATGTATAGG - Intronic
1039625375 8:39045317-39045339 AGGTGTACACACACATGTATAGG - Intronic
1041274351 8:56142223-56142245 AGGTGTGCACACACTTGGGGTGG + Intergenic
1041567149 8:59291764-59291786 ACGTGTGCACATACACGTGTTGG - Intergenic
1042663787 8:71184074-71184096 ACATGTGCACACACAAGCACAGG - Intergenic
1044311085 8:90693353-90693375 GTGTGTGCACGCACATGTGTAGG + Intronic
1045132793 8:99175793-99175815 ACTTATGCACACAAATGCTTAGG + Intronic
1045648058 8:104318407-104318429 GCGTGTGCACTCAGATGCATGGG - Intergenic
1046619201 8:116510040-116510062 ATGTGTGCACACACGTGCGAGGG - Intergenic
1047133188 8:122045800-122045822 ACGTGTGCACGCACATTTTTGGG + Intergenic
1048737103 8:137514110-137514132 GTGTGTGCACACAAATGAGTAGG + Intergenic
1049367052 8:142244944-142244966 GCGTCTGCACACAGGTGCGTGGG - Intronic
1049910911 9:266974-266996 ACCTGTGCAAACACCTGCTTTGG + Intronic
1050137595 9:2483427-2483449 ATGTGTACACACTCATGTGTCGG - Intergenic
1050263668 9:3867771-3867793 GCGTGTGCATGCACATGTGTTGG + Intronic
1051369517 9:16346315-16346337 ACGTGTACACACACACTCCTGGG - Intergenic
1052665711 9:31492564-31492586 ATGTGTGCACACACATAAGAAGG - Intergenic
1053730176 9:41046445-41046467 ATGTGTGCACACGCATGGGATGG - Intergenic
1057131786 9:92659146-92659168 ACGTGAGCACACACACGTATGGG + Intronic
1057995535 9:99819687-99819709 CCGTGCGCACACACATGCACGGG + Intergenic
1060773882 9:126354669-126354691 ACATATATACACACATGCGTGGG + Intronic
1061053737 9:128210808-128210830 AGGTGTGTGCACACATGGGTGGG - Intronic
1062049796 9:134441388-134441410 ACGTGCTCACACAGATGCTTTGG + Intergenic
1062161218 9:135081147-135081169 ACCTGAGGACACACAGGCGTGGG + Intronic
1062197986 9:135285183-135285205 ACGTGTGCACATGCCTGTGTGGG - Intergenic
1062198032 9:135285432-135285454 ACGTGTGCACATGCCTGTGTGGG - Intergenic
1062198090 9:135285746-135285768 ACGTGTGCACATACCTGTGTGGG - Intergenic
1062198099 9:135285806-135285828 ACGTGTGCACATGCCTGTGTGGG - Intergenic
1062198134 9:135285995-135286017 ACGTGTGCACATGCCTGTGTGGG - Intergenic
1062198190 9:135286307-135286329 ACGTGTGCACATGCCTGTGTGGG - Intergenic
1062198216 9:135286491-135286513 ACGTGTGCACATGCCTGTGTGGG - Intergenic
1185531584 X:823473-823495 ACATGTTCTCACACATGTGTGGG - Intergenic
1186453034 X:9689069-9689091 ACTTGTGCACACACACGCACAGG - Intronic
1187977568 X:24718705-24718727 GCGTGTGCACACACACGTGGAGG + Intronic
1189516288 X:41716370-41716392 ATGTGAGCACACACTTGCGAAGG - Intronic
1190217782 X:48491630-48491652 ATCTGTGCACACACACACGTGGG - Intergenic
1190217846 X:48492118-48492140 ACGTGAGCATACTCATGCATGGG - Intergenic
1194738320 X:97541703-97541725 ATATGTGCACACACATGTGAGGG + Intronic
1195386649 X:104319951-104319973 ACATGTGCACACACATGTGCAGG + Intergenic
1197884394 X:131203306-131203328 ACGCATGCACACACATTTGTAGG - Intergenic
1199013144 X:142780479-142780501 ACATGTGCAAACACATGCAAGGG + Intergenic