ID: 1104925114

View in Genome Browser
Species Human (GRCh38)
Location 12:132309950-132309972
Sequence CCCGGGTGACCTCGCCGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104925114 Original CRISPR CCCGGGTGACCTCGCCGCTG AGG Intronic
902333998 1:15744462-15744484 CGTGGGTGACCTGGCAGCTGTGG + Exonic
904005577 1:27361502-27361524 CCCAGGTGAAGTCGCTGCTGAGG - Exonic
904035302 1:27555760-27555782 CCCTGGAGACCTCCCAGCTGGGG + Intronic
908494029 1:64676898-64676920 CCTGGTGGACCTCGCAGCTGGGG - Exonic
913963131 1:143354270-143354292 CCCCGATGACCTCGCGACTGAGG - Intergenic
914057487 1:144179856-144179878 CCCCGATGACCTCGCGACTGAGG - Intergenic
914121659 1:144786510-144786532 CCCCGATGACCTCGCGACTGAGG + Intergenic
917919876 1:179742838-179742860 CCTGGATGTCCCCGCCGCTGAGG - Intergenic
922416638 1:225428135-225428157 CCCGGGCGGCCTCGCCGGTGGGG - Intronic
923275129 1:232388896-232388918 CCCCGCTGACCCCGCTGCTGAGG - Intergenic
1070130683 10:73653429-73653451 CCCCGTCGACCTCGCCGCCGAGG - Exonic
1070481961 10:76891496-76891518 CTCAGGTGACCTCGGTGCTGTGG + Intronic
1070717128 10:78730882-78730904 CCCGGTTAACCTCGCCGACGAGG - Intergenic
1073136798 10:101224713-101224735 CCCGGGTGACCGACCCGCCGTGG + Intergenic
1074747909 10:116553774-116553796 CCTGGGTGCCCACGCTGCTGGGG + Exonic
1076677665 10:132155849-132155871 CCCGGGTGAGCTGGCCCCAGTGG + Intronic
1085430707 11:76445385-76445407 CTCGGTTGTCCTCTCCGCTGGGG + Intronic
1085533019 11:77202836-77202858 CCGTGGTGTTCTCGCCGCTGGGG + Intronic
1086731648 11:90257304-90257326 CCCGGGAGACTTCACAGCTGAGG - Intergenic
1098996848 12:77130307-77130329 CCCGGGTGGCCTCACAGTTGAGG + Intergenic
1101870374 12:108560912-108560934 CCCGGGGGAGCTCTCCGCGGAGG + Exonic
1104925114 12:132309950-132309972 CCCGGGTGACCTCGCCGCTGAGG + Intronic
1106133672 13:26958772-26958794 CCCCAGTGACCTCAACGCTGAGG - Intergenic
1113378349 13:109783722-109783744 CCGTGGTGACCGCGTCGCTGGGG + Exonic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1122906055 14:104801992-104802014 CCCGGCTGCCCTCTCCGCTGAGG - Exonic
1127929994 15:63588970-63588992 CCTGTATGACCTCGCCGCTGTGG + Exonic
1130023618 15:80251842-80251864 CGCGGGTCTCCTCGCCGCCGCGG + Intergenic
1132861246 16:2072796-2072818 ACCCCGTGACCTGGCCGCTGGGG + Intronic
1133674922 16:8062053-8062075 CACGGGTGACCTTCCCTCTGTGG - Intergenic
1136912924 16:34159325-34159347 CCCGGGTGCCCTTGCCCTTGCGG + Intergenic
1141475546 16:84270706-84270728 CCAGGGTGGCCTCGCCCATGAGG + Intergenic
1142762655 17:2050979-2051001 CCGGGGTCCCCTCGCGGCTGCGG - Intergenic
1143119757 17:4599470-4599492 CTGGAGTGACCTTGCCGCTGGGG - Intronic
1143538673 17:7557190-7557212 CCCGAGGGAACTCGCCGCAGTGG - Exonic
1144687703 17:17237055-17237077 CCCGGGTGACATCCCTGCCGTGG - Exonic
1146850246 17:36215570-36215592 CCCTGGTGGCCTTGCCTCTGTGG - Intronic
1147686207 17:42288276-42288298 CCCGGGGGACCCCGCCGTCGGGG + Exonic
1148454920 17:47806071-47806093 CCCCGCTGCCCTCGCCCCTGGGG - Intergenic
1149868104 17:60161727-60161749 CCCTGGTGACCACGCAGCTGTGG + Intronic
1155002889 18:21704259-21704281 CCCGGCTGACTTCTGCGCTGCGG - Intronic
1155928972 18:31685640-31685662 CCGCGGTGACCGCGCTGCTGGGG + Intronic
1156465929 18:37347832-37347854 CCCTGCTGACCTGGCTGCTGTGG + Intronic
1158274159 18:55748408-55748430 CCCGCCTGACCTGGCCCCTGAGG + Intergenic
1158668729 18:59455715-59455737 CCTGGGTCACCTTGCTGCTGAGG + Intronic
1161217640 19:3102421-3102443 CCCGGCTCACCCCGCTGCTGAGG - Intronic
1166735270 19:45080177-45080199 CCCTGGTGACCTGGCCCCAGAGG - Intronic
1167125504 19:47545731-47545753 GCCGGGGGACCTGGCCTCTGGGG + Exonic
1167903147 19:52637315-52637337 CCCAGGTGTCCTCCCTGCTGTGG + Intronic
1167913831 19:52724712-52724734 CCCAGGTGTCCTCCCTGCTGTGG + Intronic
1167921338 19:52785711-52785733 CCCAGGTGTCCTCCCTGCTGTGG + Intronic
1167937840 19:52922344-52922366 CCCAGGTGTCCTCCCTGCTGTGG + Intergenic
1167991833 19:53366749-53366771 CCCAGGTGTCCTCCCTGCTGTGG - Intronic
925170494 2:1747357-1747379 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
925170517 2:1747476-1747498 TCCGGGTGCCATCGCCCCTGCGG + Intergenic
926644589 2:15275522-15275544 CCCAGGTGACCTCATCACTGTGG - Exonic
947966486 2:234286410-234286432 CCAGGGTGACGTGGCCACTGGGG + Intergenic
948542004 2:238697748-238697770 CCCAAGTGACCTCCCTGCTGGGG + Intergenic
1176156890 20:63626647-63626669 CCGGGGGGACCACGCCGCAGGGG - Intronic
1179464419 21:41562278-41562300 CCCGGGTGACCGCAGGGCTGGGG - Intergenic
1181620292 22:24086444-24086466 CACGGGAGACCACGCCTCTGTGG - Intronic
1183370146 22:37427521-37427543 CCCGGGCGCCCTCCCCGCCGAGG - Intergenic
1183903315 22:41022065-41022087 CCCGGGGGCGCGCGCCGCTGGGG + Intergenic
1185188807 22:49419812-49419834 CTCAGGTGACCTCGCGTCTGAGG + Intronic
954752007 3:52819108-52819130 CCCGGGTGAGCTCGCATCTGAGG + Exonic
958798833 3:98733245-98733267 CCCGGGTGCCCTCTCGGCGGTGG - Intronic
966595185 3:181719545-181719567 CCCGGGTCACCTCACCCATGGGG + Intergenic
968225553 3:196969916-196969938 ACCCGGTGGCCTCGCCGCTGCGG + Intergenic
968497311 4:925989-926011 CCCGGGTGGGCTCACCACTGGGG - Intronic
973242276 4:47969701-47969723 CTCGGGTGATCTCCCCGCTTTGG + Intronic
974235851 4:59180097-59180119 CCCGGGTCACCTCTCCACTGAGG + Intergenic
992067443 5:73120656-73120678 CCTGGCTGACCGCGCTGCTGTGG - Exonic
997479835 5:134176782-134176804 GCCGGCTGGCCTCACCGCTGCGG - Intronic
1006535697 6:34696959-34696981 CCCGCGTGACCTCACCGCTGCGG + Intergenic
1007485636 6:42178918-42178940 CCATGGTGACCCCTCCGCTGGGG - Intronic
1010378958 6:75205414-75205436 CCCTGGTTATCTCGCGGCTGTGG - Intronic
1015388275 6:132651143-132651165 CCTGGGTCACCACCCCGCTGTGG + Intergenic
1017110239 6:150925247-150925269 CCCGGGAGACCACGCGGCGGGGG - Intronic
1023736522 7:43240652-43240674 CTCAGGTGACCTAGCAGCTGTGG + Intronic
1027260588 7:76461964-76461986 CCCGGGTGTCCCCGCCGCCCCGG - Intronic
1027311967 7:76960077-76960099 CCCGGGTGTCCCCGCCGCCCCGG - Intergenic
1049178170 8:141206605-141206627 CCCGGGTTACCCAGCTGCTGGGG - Intergenic
1049385639 8:142341658-142341680 CGGGGGTGACCTCGCTGGTGTGG - Intronic
1049406028 8:142452219-142452241 CCCGGGAGACCCGGCGGCTGAGG + Intronic
1049535845 8:143181367-143181389 CCAGGGGGACCACGCAGCTGCGG - Intergenic
1049735123 8:144200798-144200820 CCCAGGTGACCATGCCTCTGAGG + Intronic
1049799741 8:144512241-144512263 CCCGGGGGACTTGACCGCTGAGG - Exonic
1054147547 9:61573960-61573982 CTCGGGTCCCCTCTCCGCTGGGG + Intergenic
1057701253 9:97364635-97364657 CCCTGGAGACCTCGTCTCTGGGG + Intronic
1057881524 9:98796294-98796316 CCCGACTGCCCCCGCCGCTGCGG + Exonic
1061814020 9:133182427-133182449 CCAGGCTGACCTGGCCTCTGTGG - Intergenic
1062234798 9:135502655-135502677 ACCGTGTGACCTCTCCACTGGGG - Intronic
1062622539 9:137429305-137429327 GCCGGAAGACCTCGCCCCTGGGG - Exonic
1062623501 9:137433085-137433107 ACCCGGGGACCCCGCCGCTGAGG - Intronic
1194766551 X:97848897-97848919 CCCGGGAGACTTCGCTGATGCGG - Intergenic
1200085363 X:153601600-153601622 CCTGGGTCACCTCGGCGCAGTGG + Intergenic
1201077059 Y:10196510-10196532 CCCGGGTGACCTTGCCCTCGCGG + Intergenic