ID: 1104926620

View in Genome Browser
Species Human (GRCh38)
Location 12:132317217-132317239
Sequence TGCTCTGTGGAGTCTAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104926620_1104926626 1 Left 1104926620 12:132317217-132317239 CCCATCCTAGACTCCACAGAGCA 0: 1
1: 0
2: 4
3: 11
4: 137
Right 1104926626 12:132317241-132317263 GGCCTGAATCCCATACCCCATGG 0: 1
1: 0
2: 1
3: 34
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104926620 Original CRISPR TGCTCTGTGGAGTCTAGGAT GGG (reversed) Intronic
900394848 1:2449041-2449063 TGCTCTGAGGAGGCTCAGATGGG + Intronic
901777342 1:11569491-11569513 TGCTCTGGGGACTCTGGGAGTGG + Intergenic
903786422 1:25864155-25864177 TGCTGTGTGGAGCCTGGGACCGG - Intronic
904566774 1:31433025-31433047 TGCTGTGTGGCGTCTAGCATAGG - Exonic
907108917 1:51908786-51908808 TTCTCTATGTAGTCTTGGATAGG + Exonic
908627264 1:66058723-66058745 TGCTGTGTGCAGCCTAGGCTTGG - Intronic
909593653 1:77380234-77380256 TGCTCTGGGGGCTCTAGGCTTGG - Intronic
910462239 1:87460019-87460041 AGCTTTGTGGACTTTAGGATGGG + Intergenic
913298474 1:117345327-117345349 AGCTCTGTGAGGTCCAGGATGGG - Intergenic
913342358 1:117771612-117771634 TGATCTGTGTAGTCTTGCATTGG + Intergenic
914739896 1:150455580-150455602 TGTTCTGTGGTATCTTGGATGGG + Intronic
921278366 1:213541727-213541749 AGCTGTGTGGAGACTAGGAATGG + Intergenic
922671805 1:227514257-227514279 TGCTCTGTGGAGAATAGCAATGG + Intergenic
1066249385 10:33618200-33618222 TGCTCTGTGGATTCTTGCCTTGG - Intergenic
1066530805 10:36336922-36336944 TGGGCTCTGAAGTCTAGGATTGG - Intergenic
1066641247 10:37556464-37556486 TGCGCTGTGGAGTGTAGGTGGGG - Intergenic
1067793702 10:49306055-49306077 TGCTCTGTGGAGACACGGAGAGG + Intronic
1069626765 10:69872982-69873004 TGCTCTGTGGAGTCTAGCCTGGG + Intronic
1070387746 10:75941202-75941224 TGGCCTGTGGAGTATAGGGTGGG - Intronic
1073124979 10:101143485-101143507 TGCTCTGTGGATTGGAGGATCGG + Intergenic
1073302461 10:102479449-102479471 TACTGTGTGAAGTCTGGGATTGG + Exonic
1074911800 10:117917450-117917472 TGCTATGTGGTATCTTGGATTGG + Intergenic
1076589748 10:131574882-131574904 TGCTCTGCTGAGTCAAGGTTGGG + Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078098107 11:8312813-8312835 TGCTCTCTGGGGTCTAGAACAGG + Intergenic
1079034059 11:17007151-17007173 TGCTCTATGGTGTCTTGGAGTGG + Intronic
1080757068 11:35211525-35211547 TTTTCTGTGTAGTCTGGGATTGG + Intronic
1084270421 11:68026571-68026593 TGCTCTGGGGGGTGGAGGATTGG - Intronic
1086205620 11:84255065-84255087 TGCTCTGTGTAGTCTGGGGTGGG - Intronic
1087156418 11:94909301-94909323 TACCCTGTGGAGTCTAGGTGGGG + Intergenic
1095686467 12:45041383-45041405 TGCTCTTTGGAGTCTTGTTTTGG - Intronic
1095781720 12:46067394-46067416 TGCTGTGCTGAGTCTAGGCTGGG - Intergenic
1095880956 12:47135642-47135664 TACTCTGTGAAGTCTAGGACAGG - Intronic
1098346644 12:69512022-69512044 AGCTCTGTGGAGTCTGGCAAAGG - Intronic
1101816560 12:108150444-108150466 AGAGGTGTGGAGTCTAGGATGGG + Intronic
1102221883 12:111200514-111200536 TGCTGGGGGGAGGCTAGGATGGG + Intronic
1104651407 12:130537105-130537127 TGCAGTGTGGTGTCTTGGATGGG + Intronic
1104926551 12:132316897-132316919 TGCTCTGTGGGGTGTAGAATGGG - Intronic
1104926580 12:132317034-132317056 TGCTCTGTGGGGTGTAGAATAGG - Intronic
1104926589 12:132317082-132317104 TGCTCTGTGGGGTGTAGGATGGG - Intronic
1104926608 12:132317164-132317186 TGCTCTGTGGGGTGTAGGATGGG - Intronic
1104926620 12:132317217-132317239 TGCTCTGTGGAGTCTAGGATGGG - Intronic
1104978085 12:132561015-132561037 TGCTGTGTGTGGTCTAGGAAGGG + Intronic
1105376644 13:19851445-19851467 TGGTCTGTGGAGTTAAAGATGGG + Exonic
1107959018 13:45542734-45542756 TGCTCTGAGAAATCCAGGATAGG + Intronic
1108013476 13:46048259-46048281 TGCCTTAGGGAGTCTAGGATTGG - Intronic
1113098149 13:106688271-106688293 TGCTCTGAGGAGGTTTGGATGGG + Intergenic
1114699497 14:24662962-24662984 TGCTCTGTGGTGGCTCTGATTGG + Intergenic
1117301908 14:54438561-54438583 TGCTCTGTGGAGAATAGAGTCGG - Intronic
1122717954 14:103706671-103706693 GGCTCTGTGGACTCTGGGCTTGG + Intronic
1126345128 15:47685598-47685620 TGCTCTGTGGTGTCTTGAAGGGG - Intronic
1128681064 15:69651992-69652014 TGCTCTGAGGACTTTAGCATGGG + Intergenic
1130862665 15:87904793-87904815 TGCTCTGTGGAGTCCCAGCTGGG - Intronic
1131925774 15:97382395-97382417 TGCTGGGTGGTGACTAGGATTGG - Intergenic
1132576375 16:666229-666251 TCCTCTCTGGAGACAAGGATGGG + Exonic
1141346056 16:83247096-83247118 GGCACTGTGGATTTTAGGATTGG + Intronic
1142029634 16:87832068-87832090 TGCTGTGTGGAGCCCAGGGTGGG + Exonic
1145259058 17:21343919-21343941 TGCTGTGTGCAGTCTCTGATGGG + Intergenic
1145317560 17:21744084-21744106 TGCTGTGTGCAGTCTCTGATGGG - Intergenic
1145741129 17:27275603-27275625 TGGCCTGTGGAGTCCAGGAGCGG + Intergenic
1149725360 17:58887808-58887830 TGCTGTGTGGAGACTAGAGTAGG + Intronic
1152580456 17:81163443-81163465 TGCTCTGGGGAGACTAGTGTGGG - Intronic
1153286250 18:3457482-3457504 AGCTCTGTGGAGTCCGTGATGGG + Exonic
1157515843 18:48310754-48310776 TGCTCTGGGGAGTCTGAGATGGG + Intronic
1158183688 18:54747126-54747148 TGCTCTATGGAGAGTAGGCTGGG - Intronic
1159812777 18:73036309-73036331 TGTACTGCGGTGTCTAGGATGGG + Intergenic
1160461732 18:79043802-79043824 AGCTCTGCTGAGTCTAGCATGGG + Intergenic
1161341899 19:3747639-3747661 TTCTCTGTTGACTCCAGGATGGG - Intronic
1164624318 19:29716084-29716106 TGCTCTTAGGAGTCTTGGATGGG + Intergenic
1166604860 19:44132116-44132138 TCCACTGTGGACTCTACGATGGG - Exonic
1167758114 19:51426116-51426138 TGCTCTGGGGAGGAGAGGATAGG + Intergenic
927880388 2:26686174-26686196 TGCTCTGTGTAGTCCAGAAGGGG - Intergenic
932268487 2:70388500-70388522 AGCTCCCTGGAGTCTAGGACTGG - Intergenic
941508517 2:166376487-166376509 GGCTCTGAAGAGTCTAGGCTGGG + Intergenic
942919924 2:181359994-181360016 TGGGCTGGGGAGTCTAGGACTGG + Intergenic
943168040 2:184357452-184357474 TGCTCTGTTGAGACTAGACTGGG + Intergenic
944632653 2:201643019-201643041 TCCTCGGAGGAGTCTAGGAGAGG + Intronic
947335565 2:229079424-229079446 TGCTCTGAGGAATCAAAGATGGG + Intronic
948948142 2:241232015-241232037 TGCTCTGTTGTCTCTAGGTTAGG - Intronic
1170536966 20:17349932-17349954 TGCACTGTGCAGTCAAGGCTGGG + Intronic
1171306142 20:24108259-24108281 TGCTGTGTTCAGTTTAGGATGGG - Intergenic
1171872021 20:30536060-30536082 TTCTCTGTCTAGTCTAGGACTGG + Intergenic
1173671549 20:44802576-44802598 GGCACTGTGGAGTCCAGGCTGGG - Intronic
1173842093 20:46164315-46164337 TGCTCTGTGGGGCCTGTGATTGG + Intergenic
1175914597 20:62419777-62419799 TGGGCTGTGGAGTCCAGGAGAGG + Intronic
1178166610 21:29985352-29985374 TTCTAGGTAGAGTCTAGGATTGG + Intergenic
1181403714 22:22667292-22667314 TGCTCAGGGGAGTCTCGGGTGGG + Intergenic
1181624367 22:24113390-24113412 TGCTCCGTGGCCTCTGGGATGGG + Intronic
1184825253 22:46946265-46946287 TCCTCTGTGCAGCCAAGGATGGG - Intronic
952369100 3:32702326-32702348 TGCTCTGAGTAGTTTAGGTTTGG + Intronic
952918366 3:38266855-38266877 TGCTCGGAGGTGGCTAGGATGGG - Intronic
953720753 3:45352855-45352877 TGCAATGTGGAGTCCTGGATAGG - Intergenic
955446814 3:59020636-59020658 TGCCCTGTTGATTCTAGGCTTGG + Intronic
961300999 3:125921953-125921975 TGCCCTGTGAATTTTAGGATGGG + Intergenic
961887525 3:130106144-130106166 TGCCCTGTGAATCCTAGGATGGG - Intronic
964758732 3:160113581-160113603 TGCAATGTGGCGTCTTGGATGGG + Intergenic
965313820 3:167165412-167165434 TTCTCTGTGGAGTGAAGGAGAGG - Intergenic
966789877 3:183657311-183657333 TGCTCAGTGGAGTCTGGCAAAGG - Intronic
970058950 4:12007822-12007844 TGCTCTGTGGACTAGAGTATGGG - Intergenic
970263588 4:14256068-14256090 TGCACTGTGGAGAATAGAATGGG + Intergenic
975755636 4:77568758-77568780 TGCTCTGTGGTGTTTGGCATTGG + Intronic
976344432 4:83984298-83984320 TGCTCTGTGGTGTCCAGGGGTGG + Intergenic
978373155 4:108049541-108049563 TGCTCTCTGGAGTGAAGGAACGG - Intronic
978907244 4:114021102-114021124 TCCTCTGTGGATTCTACGTTTGG - Intergenic
981048221 4:140285507-140285529 TGCTCACTGTATTCTAGGATGGG + Intronic
982560536 4:156924094-156924116 TTCTCTGTGGATTTTAGGCTAGG - Intronic
984744681 4:183202811-183202833 TGCTCTCTGGAGTCAAGGCTGGG + Intronic
985092158 4:186374510-186374532 TGCTCTGTGGAGAATGGGTTGGG - Intergenic
986412436 5:7494027-7494049 TGCTCTGTGCAATGTAGGCTTGG + Intronic
990942712 5:61219490-61219512 AGCTCTGGAGAGTCTTGGATTGG + Intergenic
991111692 5:62907383-62907405 TGCTCTGTGGTATCCTGGATGGG - Intergenic
991407911 5:66319801-66319823 TGCTCTGTGCAGCCTGGGAGGGG + Intergenic
994474188 5:100246388-100246410 TACTCTGTGGTGTCTATGTTAGG - Intergenic
997294078 5:132759195-132759217 GGCTCTGTGGAGGCCAGGAATGG - Intronic
997926337 5:138033571-138033593 TTCTCTCTGGAGTCTAGGTCAGG - Intronic
998632558 5:143915913-143915935 TGCAATGTGGAGGATAGGATAGG + Intergenic
999089238 5:148920957-148920979 TGGACTGTGGAGTCCAGGAATGG - Intergenic
1001822157 5:174718922-174718944 TGGGCTGTTGAGTCCAGGATGGG - Intergenic
1004486593 6:16072317-16072339 TGCAATGTGGAGTCAAGGTTGGG - Intergenic
1004555664 6:16695114-16695136 GGCTCTATGGAGACTATGATGGG + Intronic
1006162904 6:32048400-32048422 TGCTCTTTGGACTCCAGAATGGG - Intronic
1006167206 6:32072027-32072049 TGCTCTTTGGGATCCAGGATGGG - Intronic
1006894353 6:37457485-37457507 TGCAGTGTGGTGTCTTGGATTGG + Intronic
1006950215 6:37815792-37815814 TGCTCAGTGGGGTCTAGTAAAGG - Intergenic
1008509461 6:52262702-52262724 TGCTCTGAGGCTTCTAGGCTGGG - Intergenic
1008714632 6:54273946-54273968 TGAGCTATGGAGTCTAGGTTTGG + Intergenic
1009537233 6:64903786-64903808 TTCTCTGTGGTGTCTACCATTGG + Intronic
1015407762 6:132856647-132856669 TGCTAGGTGCAGTGTAGGATAGG + Intergenic
1015459108 6:133468136-133468158 GTCTCTGTGGAGTCTAGGAGGGG + Intronic
1018416556 6:163606798-163606820 TGCTGTGTGGAGGCCAGGAAGGG - Intergenic
1021131081 7:16913574-16913596 TGAGCTGTGCAGTCTAGGGTTGG + Intergenic
1027374392 7:77536671-77536693 CGGTCTGTGGAGTCCAGGAGTGG - Intergenic
1034269277 7:149795816-149795838 TGCTCTGTGGAGCCGAGGCTTGG + Intergenic
1034979797 7:155468267-155468289 TCCTCTGTGGGGTCGAGGAATGG + Intergenic
1036208983 8:6826857-6826879 TGCACTGTGGATTACAGGATGGG + Intronic
1037572465 8:20170089-20170111 TGCCCTGAGGAGTCCTGGATGGG + Intronic
1038049910 8:23798795-23798817 TGATCTGTGAAGCCCAGGATGGG - Intergenic
1040315359 8:46258054-46258076 AGCTCTGGGGATTCTGGGATGGG - Intergenic
1043011055 8:74882305-74882327 TGGTATTTGAAGTCTAGGATGGG + Intergenic
1045025748 8:98084916-98084938 GGCTCTTTGGAGACTGGGATTGG - Intronic
1045111825 8:98944106-98944128 TTCTCTGTGGAGTCTTTGAGAGG + Intergenic
1045294144 8:100859489-100859511 TGCCCTGAGGTGTCTCGGATGGG - Intergenic
1046258769 8:111738152-111738174 TACTCTGTGAAGTCTTGTATTGG + Intergenic
1047990096 8:130277103-130277125 TGATCTGGAGAGTCTGGGATGGG - Intronic
1049750380 8:144280335-144280357 AGCTCTGTGGAGTCTGGAAAGGG - Intronic
1051372774 9:16372456-16372478 TGCTCTATGGAGAATAGGACAGG + Intergenic
1056634865 9:88323177-88323199 TGCTCTGTAGAGTCTGGGATGGG + Intergenic
1058735594 9:107891236-107891258 TGCTCCTTGGAGTCTCGGAGGGG - Intergenic
1060195769 9:121622435-121622457 TGCTTTGAGGAGGCCAGGATGGG + Intronic
1062723549 9:138058260-138058282 CGCTCTGTGGAGTCTTGCAGTGG + Intronic
1186540138 X:10391961-10391983 TGCTCTGTGGAGACTCAGAGGGG - Intergenic
1189335290 X:40167433-40167455 TGCTCTGGGGAGGGGAGGATCGG + Intronic
1190898982 X:54650691-54650713 GGAGCTGTGGAGTCTAGGGTTGG - Intergenic