ID: 1104927326

View in Genome Browser
Species Human (GRCh38)
Location 12:132320726-132320748
Sequence CCGCCCCCACCAGGTGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104927321_1104927326 -3 Left 1104927321 12:132320706-132320728 CCTGGGCCAGCTCAAGGCCTCCG 0: 1
1: 0
2: 4
3: 22
4: 268
Right 1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG 0: 1
1: 0
2: 2
3: 31
4: 292
1104927318_1104927326 4 Left 1104927318 12:132320699-132320721 CCATGTCCCTGGGCCAGCTCAAG 0: 1
1: 0
2: 0
3: 24
4: 241
Right 1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG 0: 1
1: 0
2: 2
3: 31
4: 292
1104927320_1104927326 -2 Left 1104927320 12:132320705-132320727 CCCTGGGCCAGCTCAAGGCCTCC 0: 1
1: 0
2: 2
3: 35
4: 302
Right 1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG 0: 1
1: 0
2: 2
3: 31
4: 292
1104927322_1104927326 -9 Left 1104927322 12:132320712-132320734 CCAGCTCAAGGCCTCCGCCCCCA 0: 1
1: 0
2: 1
3: 23
4: 279
Right 1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG 0: 1
1: 0
2: 2
3: 31
4: 292
1104927317_1104927326 10 Left 1104927317 12:132320693-132320715 CCAACTCCATGTCCCTGGGCCAG 0: 1
1: 0
2: 1
3: 34
4: 349
Right 1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG 0: 1
1: 0
2: 2
3: 31
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104927326 Original CRISPR CCGCCCCCACCAGGTGCCCT CGG Intronic
900151151 1:1179864-1179886 CTGGCCCCACCAGGCGGCCTGGG - Intronic
900411535 1:2514816-2514838 TCGCCCCTCCCAGTTGCCCTGGG + Intronic
900665697 1:3814179-3814201 CCCCTCCCACCTGGTGCCCAGGG - Exonic
900737855 1:4310386-4310408 CCGTCCCCAGCAAGTGTCCTTGG - Intergenic
900888112 1:5429751-5429773 CCGCCTCCACCCTGTGCTCTGGG - Intergenic
902280550 1:15371249-15371271 CCGCCCACACCAAACGCCCTTGG + Intronic
902756872 1:18554749-18554771 CTGCCCCCACCAGGAGCTCCCGG - Intergenic
902916840 1:19644556-19644578 GCGCCTCCACCCGGTGCCCGCGG - Intronic
903278091 1:22234103-22234125 CCTCCCCCACCAGTTTCCCCAGG + Intergenic
903310510 1:22451794-22451816 CCGCCCCCAGCACGTGACCGCGG + Intergenic
903737760 1:25541196-25541218 CGGACACCACCAGCTGCCCTTGG + Intergenic
905028946 1:34868789-34868811 CCGCCCCCACCCCCGGCCCTGGG - Exonic
907513800 1:54980805-54980827 CCGCCCGCACCCGGTGCGCAGGG - Exonic
910759236 1:90718639-90718661 CCGCGTCCACCAGGCGCTCTCGG + Intergenic
910876903 1:91886259-91886281 CCGGCCCCACCGGGGGCTCTCGG + Exonic
912174530 1:107140413-107140435 CCGCCCCCACCAGCGGCTCCCGG - Intronic
914666885 1:149840106-149840128 CCGCCCACACCCCGTGCCCCCGG + Exonic
914668882 1:149853684-149853706 CCGCCCACACCCCGTGCCCCCGG - Exonic
915213193 1:154324973-154324995 CCGCCCCCACCACGCCCCCTGGG - Exonic
916107066 1:161440480-161440502 CCTTCCCCAACAGGTGCCCGGGG + Intergenic
919792756 1:201302759-201302781 CCGCCCCCACAGCGTGCCCAAGG + Intronic
919928944 1:202208803-202208825 CCACCCCCAGCAGGTGCCCTGGG - Intronic
924825114 1:247531000-247531022 CCGCTGCCACCAGGTCCCCGAGG + Exonic
1062879232 10:964907-964929 CAGGCCCCACCAGGAGCCCTGGG + Intergenic
1064230876 10:13528773-13528795 GCGCCGCCTCCCGGTGCCCTAGG + Intronic
1064274203 10:13891779-13891801 CCGCCCCCGCCGCGGGCCCTCGG + Intronic
1064391398 10:14945458-14945480 CCACCCCCACCTTGTGCTCTTGG - Intronic
1067460027 10:46451464-46451486 CCACCCCCACCCGGTGCCTCAGG + Intergenic
1067627162 10:47933149-47933171 CCACCCCCACCCGGTGCCTCAGG - Intergenic
1067777768 10:49175713-49175735 CCCCCCCCACCTGGTGTCCCAGG + Intronic
1069871889 10:71538140-71538162 CCGCCCCCACCAGGTCTCCATGG + Intronic
1070965160 10:80525800-80525822 GAGCATCCACCAGGTGCCCTAGG + Exonic
1070967670 10:80539445-80539467 CAGTCCCCACCAGGTGCCACAGG + Intronic
1073491212 10:103854829-103854851 CGGCCCTCCCCAGGGGCCCTGGG - Intronic
1075804341 10:125174639-125174661 CCATCCCCACCAGGTTGCCTGGG + Intergenic
1076869167 10:133184886-133184908 CTGCCCCCACCAGGAGCGCCAGG + Intronic
1077047002 11:551118-551140 CCTCCCCCTGCAGGTGCCCAGGG + Exonic
1077243467 11:1524251-1524273 CCGCCACCGCCAGGTGCCTATGG + Intergenic
1077327597 11:1970463-1970485 CAGCCCCCTGCAGCTGCCCTCGG + Intronic
1077432850 11:2524613-2524635 CACCACCCACCAGGGGCCCTGGG - Intronic
1078069394 11:8098243-8098265 CTGCCCCCACCTGGAGGCCTAGG - Intronic
1078108482 11:8373411-8373433 CTACCCCTACCAGGAGCCCTGGG + Intergenic
1078726986 11:13940491-13940513 CCTGCCCCACCCGCTGCCCTGGG - Intergenic
1080034524 11:27699098-27699120 CCGCCCCCAGTAGCTGCTCTTGG + Intronic
1081690175 11:45072695-45072717 CCCTCCCCACCTGGTGCTCTGGG - Intergenic
1083209533 11:61174518-61174540 CTGCCACCACCAGGAACCCTGGG + Intergenic
1083921379 11:65782819-65782841 CCCCCCACACCAGGTACCCTCGG + Intergenic
1084083873 11:66845855-66845877 CCGGCCCAATCAGGTGTCCTGGG - Exonic
1084274175 11:68043302-68043324 CCTCCCCCACCAGGCCCCCCGGG - Intronic
1084325902 11:68399926-68399948 CCGGGTCCACCGGGTGCCCTGGG + Intronic
1084618362 11:70251611-70251633 CCCCCCCCACCACGTGGCCCTGG + Intergenic
1084657275 11:70526963-70526985 CCGCCCCGCCCAGGTCACCTTGG + Intronic
1084756411 11:71241655-71241677 ACACCCCCACCAGGTTCCCAGGG + Intronic
1084859295 11:72007671-72007693 CCATCCCCACCAGATGCCCATGG + Intronic
1087014571 11:93543076-93543098 CCGCCCGCACGAGTTGCGCTCGG + Intronic
1089065479 11:115659295-115659317 CGTCCCCCACCCGGTGCTCTCGG + Intergenic
1089556329 11:119317485-119317507 CCTCCCCCAGGAGGTCCCCTAGG - Intronic
1091223836 11:133946249-133946271 CCGTCCCCATCAGGCGCCCACGG - Exonic
1202810579 11_KI270721v1_random:25643-25665 CAGCCCCCTGCAGCTGCCCTCGG + Intergenic
1091456862 12:614445-614467 CCCACCCCACCATGTCCCCTGGG - Intronic
1092259544 12:6945701-6945723 CCACCCCCTCCAGGTGTCTTAGG + Intronic
1094218336 12:27969354-27969376 CCTCCCCAACCCGGCGCCCTGGG + Intronic
1094682728 12:32679815-32679837 GCGCGTCCCCCAGGTGCCCTTGG - Intronic
1096396580 12:51270471-51270493 CCGCCCTCTGCAGGTCCCCTTGG + Exonic
1100802432 12:98247424-98247446 CTGGCCCCACCAAGAGCCCTAGG + Intergenic
1101779194 12:107820734-107820756 TGGCCCCCACCTGGTGTCCTGGG + Intergenic
1102057945 12:109910802-109910824 CAGCCACCACCACATGCCCTCGG - Intronic
1102220720 12:111192577-111192599 CTTCCCCCACCAGGAACCCTAGG + Intronic
1102259694 12:111436532-111436554 CCGACTCCACCAGGTGGCCAAGG - Intronic
1102961196 12:117094351-117094373 CCACCCTCACCAGCTGTCCTCGG - Intronic
1103750095 12:123152128-123152150 CCTCCACCAAGAGGTGCCCTAGG + Intergenic
1104363623 12:128156510-128156532 CCGCCACCCTCATGTGCCCTTGG + Intergenic
1104927326 12:132320726-132320748 CCGCCCCCACCAGGTGCCCTCGG + Intronic
1109284850 13:60397586-60397608 CCGCCGCCTCCAGGGGACCTAGG - Intronic
1113665052 13:112135780-112135802 CCGTCCCCGGCAGGGGCCCTAGG - Intergenic
1114046444 14:18880523-18880545 CCGCCCCCTCCAGAGGCCCCTGG - Intergenic
1114084538 14:19229781-19229803 CCCCCCCCACCAGGTACCACAGG - Intergenic
1114117768 14:19638927-19638949 CCGCCCCCTCCAGAGGCCCCTGG + Intergenic
1114549644 14:23525518-23525540 CCACCCCCACCTGAGGCCCTCGG - Exonic
1117072457 14:52069088-52069110 CCGCCCCGCCCAGGCGCCCGCGG - Intronic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1119382785 14:74239632-74239654 GCGCCCCGGCCAGGTGCACTGGG + Exonic
1119765878 14:77187434-77187456 CCGCCCCCACCAGGTTCCGAGGG + Intronic
1121111477 14:91316048-91316070 CCGCCACCGCTGGGTGCCCTCGG + Intronic
1121417717 14:93790263-93790285 TGGCCCCCAGCAGGTGCCCATGG - Intergenic
1122267687 14:100554320-100554342 CCGCTCCCACCCTGTGCCCCTGG + Intronic
1122635223 14:103126680-103126702 CCGCCCCCCACAGGTGCTCTAGG + Exonic
1122893266 14:104742730-104742752 CCGCCTCCCCCAGCTGCCCATGG + Intronic
1123013130 14:105358755-105358777 CCGCCCCTCACAGGTCCCCTTGG - Intronic
1125724354 15:41860749-41860771 CCACTCCCACCAGGACCCCTTGG - Exonic
1125730863 15:41892238-41892260 CAGCCACCTCCAGGAGCCCTTGG + Intronic
1125895964 15:43301929-43301951 CCCCTGCCACCAGGTGTCCTTGG - Intronic
1127844443 15:62857045-62857067 CTGCCACCACCAGCTGCTCTTGG + Intergenic
1128561680 15:68672826-68672848 CCACCCCCACCAAGTGGCCAGGG + Intronic
1128562641 15:68678759-68678781 CTGCCCACACCATGTCCCCTGGG + Intronic
1128811745 15:70578165-70578187 CCCCTCCCATCAAGTGCCCTGGG + Intergenic
1129220961 15:74131369-74131391 CGCACCCCATCAGGTGCCCTAGG - Intronic
1129691406 15:77715770-77715792 CTGTCCCCAACAGGTGCCCAGGG + Intronic
1130322794 15:82854596-82854618 CTGCCCACACCAGCTGGCCTCGG + Intronic
1130938663 15:88490334-88490356 CCACCCCCACCCCCTGCCCTTGG + Intergenic
1132405834 15:101541465-101541487 CCAGCCCCACCAGGAGCCTTGGG - Intergenic
1132497928 16:272648-272670 CCCCTCCCACCTGCTGCCCTGGG - Intronic
1132618731 16:854625-854647 CCGCACCCACCACTTGCCCTCGG + Exonic
1132672429 16:1107320-1107342 CCTCTGCCTCCAGGTGCCCTGGG + Intergenic
1132677362 16:1126325-1126347 CCTCCCTCACCAGGTGACCATGG - Intergenic
1132748559 16:1447020-1447042 CCACCACCACCAGGTGCCGCAGG + Exonic
1132812819 16:1809725-1809747 CCGCGCCCACCACCTGCCCTGGG + Intronic
1132854034 16:2036893-2036915 CCGCACCCACCCTGTGCCCTGGG - Intronic
1132855857 16:2044272-2044294 CCTCACCCTCCAGGAGCCCTGGG - Intronic
1132887790 16:2190040-2190062 CTGCCCCCACCAGAGGCCCTCGG + Intronic
1135173515 16:20208021-20208043 CTGCCCCCACCTGGAGTCCTTGG + Intergenic
1136419321 16:30122479-30122501 CCGGCCCCACCGTGTGCTCTGGG - Intronic
1136458293 16:30394958-30394980 CCACCCCCACCCCGGGCCCTCGG + Intronic
1136716867 16:32288678-32288700 CCCTCCCCACCAAGTGCCCAGGG + Intergenic
1136835243 16:33494923-33494945 CCCTCCCCACCAAGTGCCCAGGG + Intergenic
1137696342 16:50464664-50464686 GTGCCTCCACCAGGTGGCCTTGG - Intergenic
1138489282 16:57366816-57366838 CCGCCACCTCCAGGGCCCCTGGG - Intergenic
1139475479 16:67200564-67200586 CTGCCCCCACCCGCTGCCCTAGG - Intronic
1139596525 16:67961557-67961579 CCGCCCCAACCAGCTCACCTCGG + Exonic
1140411097 16:74740840-74740862 TGAGCCCCACCAGGTGCCCTGGG - Intronic
1141678336 16:85529518-85529540 CTGCCCCCAACAGGTGCCAAGGG - Intergenic
1141696991 16:85624826-85624848 CCTCCGCCACCCTGTGCCCTTGG - Intronic
1141710429 16:85695734-85695756 CCGATTCCACCAGGTGCCCATGG + Intronic
1141906316 16:87029129-87029151 ACGCCTCCCCCAAGTGCCCTGGG + Intergenic
1141995909 16:87636214-87636236 AGGCCTCCACCACGTGCCCTGGG + Intronic
1203009560 16_KI270728v1_random:229109-229131 CCCTCCCCACCAAGTGCCCAGGG - Intergenic
1203145415 16_KI270728v1_random:1795244-1795266 CCCTCCCCACCAAGTGCCCAGGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143346584 17:6253996-6254018 CTGCTCCCACCAGGTGACCCTGG + Intergenic
1144081724 17:11769338-11769360 CCCCCCACCCCAGGTGCCCTGGG - Intronic
1144726295 17:17504271-17504293 CTGCCTCCACCATGTGCCCTGGG + Intergenic
1144828827 17:18120891-18120913 CCGCCGCCACCCGCCGCCCTGGG + Exonic
1145288212 17:21522232-21522254 AGACCCCCACCAGGGGCCCTGGG - Intergenic
1145389428 17:22444211-22444233 AGACCCCCACCAGGGGCCCTGGG + Intergenic
1146255381 17:31389239-31389261 CCTCCCCCACCAGTGGCACTGGG - Intergenic
1148092567 17:45031374-45031396 CCTTCCCCACCATGTGACCTTGG + Intronic
1148733448 17:49851424-49851446 CTGCGCCCACCCGGCGCCCTGGG - Intergenic
1149598982 17:57881127-57881149 CCCTACCCACCAGGTGCCCCTGG - Intronic
1150630997 17:66880400-66880422 CTACCCCCATCAGGTGGCCTGGG - Intronic
1151758759 17:76089070-76089092 CCACCACCACCTCGTGCCCTGGG - Intronic
1151825875 17:76523851-76523873 CTGGGCCCACCAGGGGCCCTGGG + Intergenic
1152891365 17:82883464-82883486 CGGCCCCCACCAGGCTCCTTGGG - Intronic
1152923785 17:83078775-83078797 CCGCCCCCACCCCGTGCCCGCGG - Intergenic
1152930573 17:83107607-83107629 CTGCCCCCAGCAGGAGCCCCAGG - Intergenic
1154080333 18:11250041-11250063 CCAGCCCCACCAATTGCCCTCGG - Intergenic
1155446902 18:25922229-25922251 CCACCCTCAGCAAGTGCCCTAGG + Intergenic
1156239875 18:35242872-35242894 CCGTTCCCACCTGCTGCCCTGGG - Exonic
1157479420 18:48044065-48044087 CAGCCCCACCAAGGTGCCCTTGG + Intronic
1160837100 19:1129904-1129926 ACGCCCTCACCAGGTGCCCTTGG + Intronic
1160951110 19:1667794-1667816 GCGGCCCCACCAGCTGCCCCGGG - Intergenic
1160957695 19:1701304-1701326 TCTCCCCCAGAAGGTGCCCTGGG + Intergenic
1161030575 19:2056183-2056205 CCACCCCCAGCTGGAGCCCTGGG + Intergenic
1161201176 19:3015693-3015715 CCGCCACCACCAGGGCCACTCGG + Exonic
1161204678 19:3034833-3034855 CTGTCCCCACCAGATGCTCTGGG - Intronic
1161308299 19:3579001-3579023 CCACCCCCACCAGGGTCCCTCGG - Exonic
1162145187 19:8608991-8609013 CCCCCACCACCTGGTGCCCTGGG - Intronic
1162479366 19:10919766-10919788 CCCCGCCCACCATCTGCCCTGGG - Intronic
1162926200 19:13931649-13931671 CAACGCCCACCAGGGGCCCTTGG - Intronic
1163473611 19:17512172-17512194 CCGCGCCCACCGGTTGCCCTCGG + Intronic
1164684294 19:30156880-30156902 CCTACCCATCCAGGTGCCCTGGG + Intergenic
1165350586 19:35272975-35272997 GCATCCCCACCAGGTGCCCGGGG - Intronic
1165429636 19:35765164-35765186 CAGCCCTTACCGGGTGCCCTGGG - Exonic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166318819 19:42003776-42003798 CCGCCTCTACCACGTGCCCAGGG + Intronic
1166422895 19:42652473-42652495 CCGCCCTCACCAGGGTCACTTGG + Intronic
1166502923 19:43354380-43354402 CAGCCCCCAGCAGGTGCCTGCGG + Exonic
1167049722 19:47070992-47071014 GCGCCCCCACCCGCTGCCCTCGG + Intronic
1167384437 19:49155709-49155731 CTGCCTCCCCCAGGTGCCCCAGG - Intergenic
1167410338 19:49340354-49340376 CCGCCCCCGTCACGTGCGCTGGG + Exonic
1167512270 19:49901612-49901634 GTGCCCCCACCCGGGGCCCTGGG - Intronic
1167668383 19:50836121-50836143 CCGCCCCCACGCGGTGACGTCGG + Intronic
1168058817 19:53879235-53879257 CAGCCACCTCCAGGTGACCTAGG - Intronic
1168189312 19:54726384-54726406 ACGCCCCCACCAGAAGCTCTGGG - Intronic
925065412 2:925884-925906 CCAACCCCAGCAGGTGCTCTCGG - Intergenic
925148927 2:1601442-1601464 CTGCCAGCACCAGGGGCCCTGGG - Intergenic
925994444 2:9280359-9280381 CCGCCCCCACCAGTTACAATAGG + Intronic
926197970 2:10775098-10775120 CCGCCCCTACCCGGAGGCCTGGG + Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927685617 2:25168616-25168638 CCGCGCCCACCAGGAGAGCTCGG - Exonic
928128595 2:28632859-28632881 ACTCTCCCAGCAGGTGCCCTGGG - Intronic
928312543 2:30222799-30222821 CCACCCTCACCAAGGGCCCTGGG - Intergenic
928471423 2:31580460-31580482 CGGCCCCCGCCAGGTGCGCCAGG + Intronic
928580276 2:32700310-32700332 CCAGCCCCACCAAGTGACCTGGG - Intronic
932073385 2:68643162-68643184 CGGCCCCAACCTGGTCCCCTGGG - Intergenic
934563949 2:95328159-95328181 CAGCCCCCACCAGCTTCCCCAGG + Intronic
935594674 2:104869443-104869465 ACTCTCCCACCAGGTGTCCTGGG + Intergenic
937917488 2:127106231-127106253 CCGGCCCCACCGGGAGCCCAGGG - Intronic
938065517 2:128280116-128280138 CCAACCCCACCAGGGGCCCCCGG + Intronic
938067386 2:128288583-128288605 CAACCCGCGCCAGGTGCCCTGGG + Intronic
938381108 2:130837090-130837112 CCCCACCCACCGGGTGCCCAGGG - Intronic
942444523 2:176069190-176069212 CCCCTCCCAGCAGGGGCCCTGGG + Intergenic
944933508 2:204545015-204545037 CCGCTGCCATCAGGAGCCCTGGG - Intergenic
947186527 2:227460201-227460223 CCGCCGCCCCCAGGAGACCTGGG - Intergenic
1170612881 20:17928869-17928891 CCACCCTCCCCAGGGGCCCTTGG + Intergenic
1172010429 20:31843086-31843108 CCTCCCCCGACAGGTCCCCTGGG - Intergenic
1172245366 20:33442353-33442375 CAGCCCCCAGCAGGTGCTTTGGG - Intronic
1172661726 20:36573430-36573452 CCGCCCCCTCCGGGCGCGCTGGG + Intergenic
1175448536 20:59042982-59043004 CCGGCCCCTCCAGCTGCCGTCGG - Intergenic
1175788818 20:61728892-61728914 CCACCCCCTCCAGGTTCCCAAGG + Intronic
1175825901 20:61936419-61936441 CCCCCCCCCCCATCTGCCCTTGG + Intronic
1175930540 20:62491866-62491888 CCACCCCCACCAGGCTCCCAGGG + Intergenic
1175967409 20:62666375-62666397 CTGGCACCACCAGGTACCCTGGG - Exonic
1176232419 20:64039098-64039120 CCGCCCCGTCCAGGTGCCACAGG - Intronic
1178514028 21:33230656-33230678 CCGCCCCCTTGAGGTCCCCTGGG + Intronic
1179627740 21:42658126-42658148 CAGACCCCACCAGCTGCCCAGGG - Intronic
1179710302 21:43209548-43209570 CATCCCCCACCATGTCCCCTTGG + Intergenic
1180052225 21:45336364-45336386 CCTACCCCTCCAGGTGCCCTGGG - Intergenic
1180293433 22:10863421-10863443 CCCCCCCCACCAGGTACCACAGG + Intergenic
1180464980 22:15603159-15603181 CCGCCCCCTCCAGAGGCCCCTGG - Intergenic
1180496238 22:15892836-15892858 CCCCCCCCACCAGGTACCACAGG + Intergenic
1180831641 22:18909898-18909920 CTGCCCCCTCCAGCTGCCCTGGG + Intronic
1181068216 22:20316491-20316513 CTGCCTCCTCCAGCTGCCCTGGG - Intronic
1182467416 22:30525879-30525901 CAGCCCCGACCAGCTGCCCGTGG - Exonic
1183369278 22:37423310-37423332 CCGCCACCCCCAGCTTCCCTAGG + Intronic
1184148909 22:42627445-42627467 CCGCCCCGCCCAGGTGTACTGGG + Intronic
1184557571 22:45241286-45241308 CCACCTCCACCAAGTCCCCTCGG + Intergenic
1184690321 22:46114490-46114512 CCCTCCCCACCAGGGGCTCTCGG - Intergenic
1184828547 22:46969656-46969678 CTGCCTCCTCCAGGTTCCCTTGG + Intronic
1185222111 22:49634286-49634308 CAGACCCCACCAGGAGCCTTGGG - Intronic
1185339331 22:50284514-50284536 CCCACCCCACCCGGGGCCCTGGG + Intronic
1203281723 22_KI270734v1_random:135169-135191 CTGCCTCCTCCAGCTGCCCTGGG + Intergenic
949880396 3:8656544-8656566 CATGCCCCACCATGTGCCCTAGG + Intronic
952271962 3:31841727-31841749 CTGCCCCCACCAGCTGAGCTGGG + Intronic
953880481 3:46688776-46688798 CCGGCACCATCAGGTGCCCTAGG + Intronic
954371635 3:50172083-50172105 TCTCCCCCTCCAGGTGCCTTGGG + Intronic
954614120 3:51960818-51960840 CCCTCCACATCAGGTGCCCTGGG + Intronic
954822979 3:53347532-53347554 CCGCCCCCACCAGAGGGGCTAGG - Exonic
955503974 3:59612980-59613002 CCCCCCCCACCAGGGGTCCTTGG + Intergenic
961530481 3:127537244-127537266 CCCCACCCACCAGGAGCCCAGGG + Intergenic
961821486 3:129577729-129577751 CCGCCCCCACCATCTGGGCTGGG - Intronic
962437943 3:135383686-135383708 CCTTTCCCACCAAGTGCCCTGGG + Intergenic
963008891 3:140751128-140751150 CCACCCCCACCAGCTCCTCTGGG - Intergenic
968429103 4:544822-544844 CCACCACCACCACGGGCCCTGGG + Intergenic
968479169 4:826231-826253 CCGCCCCCGCCCGGCGCCCGCGG - Intergenic
968642786 4:1722628-1722650 CCTCCACCACCAGGTGCCTGTGG + Intronic
968737127 4:2303410-2303432 AAGCCCCCACCAGGAGCCGTGGG - Intronic
968957963 4:3728617-3728639 CAGGCCCGACCAGGTGCCCTGGG - Intergenic
969103394 4:4786766-4786788 CTCCACCCTCCAGGTGCCCTTGG - Intergenic
969197542 4:5575121-5575143 CTACACCCACCATGTGCCCTTGG + Intronic
969261848 4:6038680-6038702 CCCACCCCAACAGTTGCCCTTGG + Intronic
972960355 4:44446978-44447000 CCGCCCCCTCGAGGGGCTCTGGG + Intronic
975973667 4:80072367-80072389 CCGCCCTCACCAGGAGACCCTGG + Intronic
976152324 4:82104796-82104818 CTCCACCCACCAGGGGCCCTTGG - Intergenic
979278063 4:118835694-118835716 CCGCCCCCACCTTTTGCCTTGGG - Intronic
981926142 4:150141498-150141520 CCCTACCCACCAGGTGCCTTTGG - Intronic
983275073 4:165606973-165606995 CCCCCCACAACAGGTGCCCAGGG + Intergenic
984792145 4:183624795-183624817 CGGGTCCCACCTGGTGCCCTAGG + Intergenic
985649420 5:1100431-1100453 CAGCAGCCCCCAGGTGCCCTGGG + Intronic
985717450 5:1470560-1470582 CAGCCCCACCCAGGTGCCCCAGG + Intronic
986317654 5:6601406-6601428 CCGCCTCCAGCAGGTCCCCAGGG + Intronic
995444436 5:112227070-112227092 CTGCTCCCAACAGCTGCCCTGGG + Intronic
998484755 5:142491882-142491904 TCGCGACCACCAGGTGCCCAAGG + Intergenic
999318952 5:150601450-150601472 CTGGCCCCACCATGTGCCCCAGG + Intronic
999406725 5:151313107-151313129 CCACCCCCAGCAGGGGCCCATGG - Intergenic
1002211941 5:177604549-177604571 CCGCCCCCACCCTCTCCCCTCGG + Intronic
1006301934 6:33198352-33198374 CCACCCCCTCCAGGTGGCCCTGG - Exonic
1006669413 6:35720354-35720376 CAGCCCACACCAGGCTCCCTGGG + Exonic
1006756837 6:36423515-36423537 CCGCTCCCGCCAGGAGCCCGAGG - Intronic
1006932801 6:37697751-37697773 CCGCCCCCGCCCGGCGGCCTTGG + Exonic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1007169116 6:39850042-39850064 CTCTCCCCACCAGGTCCCCTGGG - Intronic
1007341115 6:41192124-41192146 CTGCCTCCACCAAGAGCCCTGGG + Exonic
1009347630 6:62635480-62635502 CCCCCCCCACCATGAGTCCTTGG - Intergenic
1015773426 6:136791833-136791855 CGGCCACCACCAGTTGCCCTTGG + Exonic
1016425882 6:143935204-143935226 CCACCCCTACCAGGTGCCTGAGG - Intronic
1017793619 6:157823024-157823046 CCGCCGCCCCCGGGCGCCCTTGG - Intronic
1018641632 6:165909228-165909250 CAGCCCCAGCCAGGGGCCCTGGG - Intronic
1019144745 6:169969535-169969557 ACGCCCTGGCCAGGTGCCCTTGG - Intergenic
1019279709 7:193549-193571 CCGCCCCCGCAAGGCGCGCTCGG - Exonic
1019478835 7:1256841-1256863 CCTGGCCCACCCGGTGCCCTGGG - Intergenic
1019528973 7:1494318-1494340 CTGCCCCCACCTCGTGCCCTGGG - Intronic
1019593512 7:1847630-1847652 CCCCCTCCAGCAGCTGCCCTCGG + Exonic
1020139175 7:5603439-5603461 CCGCCCCCACCACCTTGCCTGGG + Intronic
1020139904 7:5606461-5606483 TCGCCCCCTCCGGGAGCCCTGGG + Exonic
1020279727 7:6644096-6644118 CCGCCCCACCCAGGGGCCATGGG - Intronic
1020289934 7:6715653-6715675 ACGCCCACACCCAGTGCCCTGGG + Intergenic
1020430724 7:8113870-8113892 CCGCCCCCAGCAGCTCCCCTGGG - Exonic
1022526982 7:31044447-31044469 CCCCTCCCACCAGGTGCCCCTGG - Intergenic
1026598270 7:71752446-71752468 CCTCCTCCAGCAGGTGACCTAGG - Intergenic
1026971837 7:74473235-74473257 CTGCCCCCACCAGGTTCTCCTGG - Intronic
1029437945 7:100573186-100573208 CCGTTCCCCCCAGGTGGCCTGGG - Exonic
1029598708 7:101551203-101551225 CCCCCGCCACCCAGTGCCCTGGG - Intronic
1029626415 7:101722762-101722784 CTGCCCCAACCATGTGCCCTGGG + Intergenic
1029745733 7:102514809-102514831 CCTCCCACACCAAGTGGCCTTGG - Intronic
1029763671 7:102613788-102613810 CCTCCCACACCAAGTGGCCTTGG - Intronic
1033253079 7:139777478-139777500 CAGCCCCCACCCGGGGCCCGAGG - Intronic
1035556781 8:573048-573070 CAGCACCCACCAGGTCCACTGGG + Intergenic
1036695988 8:10975501-10975523 CCTCGCCCACCACCTGCCCTGGG + Intronic
1037812337 8:22094540-22094562 CCGCTCCCTCCAGGGTCCCTGGG - Intronic
1037829232 8:22178175-22178197 CCTCCTCCGCCAGGTGCCCTGGG - Intronic
1039989929 8:42478830-42478852 CCACCTCCACCAAGTCCCCTAGG + Intronic
1042722850 8:71843635-71843657 GCGCCCCTACCAGGTTCACTGGG + Exonic
1048572406 8:135666951-135666973 ACGCCTCCACTAGGTTCCCTGGG + Intergenic
1049200797 8:141339654-141339676 CGGCCACCACCACCTGCCCTGGG - Intergenic
1049280446 8:141741437-141741459 CGGGTCCCACTAGGTGCCCTTGG + Intergenic
1049370029 8:142259971-142259993 CCACCCTGCCCAGGTGCCCTCGG + Intronic
1050357054 9:4793223-4793245 CCGCCCACACCAAGTTACCTCGG - Exonic
1053050468 9:34957783-34957805 CCGCCACCAGCACGTGCCCGGGG - Intronic
1053146773 9:35717386-35717408 CAGCCTCCACCAGTTGCTCTTGG + Exonic
1056745284 9:89296232-89296254 CTGCCCCCAACACCTGCCCTTGG - Intergenic
1056765660 9:89443128-89443150 CCAGCCCCATCAGGTCCCCTAGG + Intronic
1057792710 9:98134660-98134682 CAGCTCCCTCCAGATGCCCTAGG - Intronic
1060849283 9:126860938-126860960 CTGACCCCAGCAGGTGCCCGGGG - Intronic
1060980046 9:127786418-127786440 CCGCCCCCACCACGGGCCTCAGG - Intronic
1061221297 9:129253720-129253742 CTGCGCTCACCAGGTGCCCGAGG + Intergenic
1061449354 9:130660155-130660177 CCGCCCCCACCCGGGCTCCTCGG - Intergenic
1061850647 9:133412959-133412981 CCCACCCCACCAGTTGCACTAGG - Intronic
1062318068 9:135978006-135978028 ACCCCCCCACCAGCAGCCCTGGG + Intergenic
1062359967 9:136183023-136183045 GAGGCCCCAGCAGGTGCCCTGGG + Intergenic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062431640 9:136529138-136529160 TGGGCCCCACCAGGTGACCTGGG + Intronic
1062452235 9:136620606-136620628 GCGTCCCCTCCAGGTGCCCTGGG - Intergenic
1185647018 X:1623189-1623211 CCGCCACGTCCAGGGGCCCTGGG - Exonic
1188005262 X:25012433-25012455 CCACCCCCGCCTGGTGCCCCAGG - Intronic
1188542680 X:31267023-31267045 CCGCCCCCACCTAGGGACCTGGG + Intronic
1189319098 X:40076651-40076673 CCGCCCCCACCAGCTGTCAATGG + Intronic
1191978953 X:66904397-66904419 CAGCCCCCATCAGGTCCCCCGGG - Intergenic
1196462180 X:115942775-115942797 CAGGTCCCACCAGGTGCTCTGGG + Intergenic
1199737019 X:150693970-150693992 GCGCCGCCACCTGCTGCCCTTGG + Intronic
1200000077 X:153055909-153055931 GCACCCGCACCAGGTGCCCCTGG + Intergenic
1200002996 X:153071864-153071886 GCACCCGCACCAGGTGCCCCTGG + Intergenic
1200004727 X:153078145-153078167 GCACCCGCACCAGGTGCCCCTGG - Intergenic
1200092939 X:153644269-153644291 CCGCCCCCGCCGGGCGCCCCGGG - Intronic
1200216813 X:154371703-154371725 CCACCCCCCGCAGGGGCCCTGGG - Intronic
1201762514 Y:17555512-17555534 CCGCCACCACTGGCTGCCCTGGG - Intergenic
1201839038 Y:18350476-18350498 CCGCCACCACTGGCTGCCCTGGG + Intergenic