ID: 1104928567

View in Genome Browser
Species Human (GRCh38)
Location 12:132326584-132326606
Sequence GACGTGGACTTCCTTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 77}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104928556_1104928567 12 Left 1104928556 12:132326549-132326571 CCCAGTGGCCCTCCCGCTCCTCC 0: 1
1: 0
2: 1
3: 36
4: 456
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928564_1104928567 -9 Left 1104928564 12:132326570-132326592 CCAGCTCCCATGAAGACGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928552_1104928567 18 Left 1104928552 12:132326543-132326565 CCCCACCCCAGTGGCCCTCCCGC 0: 1
1: 0
2: 1
3: 41
4: 391
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928549_1104928567 23 Left 1104928549 12:132326538-132326560 CCCCTCCCCACCCCAGTGGCCCT 0: 1
1: 0
2: 8
3: 132
4: 1065
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928561_1104928567 -1 Left 1104928561 12:132326562-132326584 CCGCTCCTCCAGCTCCCATGAAG 0: 1
1: 1
2: 6
3: 47
4: 613
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928551_1104928567 21 Left 1104928551 12:132326540-132326562 CCTCCCCACCCCAGTGGCCCTCC 0: 1
1: 2
2: 9
3: 103
4: 827
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928557_1104928567 11 Left 1104928557 12:132326550-132326572 CCAGTGGCCCTCCCGCTCCTCCA 0: 1
1: 0
2: 3
3: 39
4: 406
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928562_1104928567 -6 Left 1104928562 12:132326567-132326589 CCTCCAGCTCCCATGAAGACGTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928550_1104928567 22 Left 1104928550 12:132326539-132326561 CCCTCCCCACCCCAGTGGCCCTC 0: 1
1: 0
2: 5
3: 107
4: 922
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928559_1104928567 3 Left 1104928559 12:132326558-132326580 CCTCCCGCTCCTCCAGCTCCCAT 0: 1
1: 0
2: 3
3: 73
4: 715
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928558_1104928567 4 Left 1104928558 12:132326557-132326579 CCCTCCCGCTCCTCCAGCTCCCA 0: 1
1: 0
2: 7
3: 98
4: 945
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928560_1104928567 0 Left 1104928560 12:132326561-132326583 CCCGCTCCTCCAGCTCCCATGAA 0: 1
1: 1
2: 6
3: 33
4: 337
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928554_1104928567 16 Left 1104928554 12:132326545-132326567 CCACCCCAGTGGCCCTCCCGCTC 0: 1
1: 0
2: 1
3: 32
4: 335
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928553_1104928567 17 Left 1104928553 12:132326544-132326566 CCCACCCCAGTGGCCCTCCCGCT 0: 1
1: 0
2: 2
3: 20
4: 252
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77
1104928555_1104928567 13 Left 1104928555 12:132326548-132326570 CCCCAGTGGCCCTCCCGCTCCTC 0: 1
1: 0
2: 3
3: 36
4: 378
Right 1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG 0: 1
1: 0
2: 1
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104928567 Original CRISPR GACGTGGACTTCCTTCCACC AGG Intronic
900594306 1:3473513-3473535 GCCGTGGACTTACATCCATCAGG - Exonic
901772277 1:11536560-11536582 GACCCGGACTTCCTTCCTCAAGG + Exonic
902713919 1:18259505-18259527 TAGGGGGACTTCCTTCCAACAGG - Intronic
905336308 1:37247051-37247073 AACGTAGCCTTCCTTCCTCCTGG - Intergenic
907926971 1:58964435-58964457 CACGTGCACTTCCTTCTGCCTGG + Intergenic
908476779 1:64496782-64496804 GACATGGACTGCCTTCCTACAGG + Intronic
921213623 1:212919916-212919938 GATGTAGGCTGCCTTCCACCTGG + Intergenic
921664051 1:217845378-217845400 GAGTTGGGCTGCCTTCCACCTGG - Intronic
1070761714 10:79028168-79028190 GACCTGCAGTTCTTTCCACCAGG + Intergenic
1077174663 11:1183405-1183427 GACGTGGACTTCCCGTCCCCCGG + Intronic
1077174880 11:1184524-1184546 GACGTGGACTTCCCGTCCCCCGG + Intronic
1077176200 11:1192057-1192079 GACGTGGACTTCCCATCCCCTGG + Intronic
1078274279 11:9827746-9827768 GACTTGGAGTTCCTTCGATCTGG + Intronic
1079459474 11:20667807-20667829 CACGTGTTTTTCCTTCCACCCGG - Intergenic
1080376473 11:31718677-31718699 GACCTGGACTTCCTCACACATGG + Intronic
1081963590 11:47156068-47156090 GAGGTGGCCTTCCTGCCAACTGG + Intronic
1082671816 11:56043919-56043941 AACATGGACTTCCATTCACCTGG + Intergenic
1083234633 11:61343728-61343750 GAGGTGGACTCCCTTCCTCCAGG + Intronic
1083561863 11:63679358-63679380 AAAATGGACTTCCTTCCAGCTGG + Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1095098080 12:38158531-38158553 GACGTGCTCTCCCTTCCCCCGGG - Intergenic
1095417121 12:41989247-41989269 GATGCGGACATCCTTCCACAAGG + Intergenic
1097052301 12:56230766-56230788 GACGTGGCCTCCGATCCACCTGG + Exonic
1099240852 12:80136615-80136637 GACTTGTTCTTCCTTCTACCTGG + Intergenic
1104928567 12:132326584-132326606 GACGTGGACTTCCTTCCACCAGG + Intronic
1112277897 13:98037738-98037760 CCTGTGCACTTCCTTCCACCTGG - Intergenic
1116852354 14:49921033-49921055 GAAGGGAACTTCCTTCCCCCTGG - Intergenic
1119421824 14:74511802-74511824 AACTTGGGCTTCCTTGCACCAGG + Intronic
1122647867 14:103207182-103207204 CTCCTGGACTTGCTTCCACCCGG - Intergenic
1128789256 15:70420838-70420860 GCCCTGGACTGCCTTCCTCCAGG + Intergenic
1137832033 16:51553132-51553154 GAGAGGGACTTCCTTCCAGCTGG + Intergenic
1141133380 16:81449942-81449964 GCAGTGAAATTCCTTCCACCTGG - Intronic
1141629576 16:85279858-85279880 GAGATGGCGTTCCTTCCACCGGG - Intergenic
1141756819 16:85996908-85996930 GGCATTGGCTTCCTTCCACCTGG + Intergenic
1142006070 16:87690106-87690128 CACGTGGACTTCCCACCACCGGG + Exonic
1142596752 17:1033538-1033560 GCCCTGGACTATCTTCCACCTGG + Intronic
1143404972 17:6671332-6671354 GCCCTGCCCTTCCTTCCACCAGG + Intergenic
1154078870 18:11234682-11234704 CACGTCCACTTCCATCCACCAGG + Intergenic
1155268129 18:24113526-24113548 GAGGTGGACTTCCCTCCCCTGGG - Intronic
1161422939 19:4185598-4185620 CACGTGCACTTCTGTCCACCTGG - Intronic
1165864960 19:38931283-38931305 GACCAGGACATCCTGCCACCTGG - Exonic
1166697228 19:44859026-44859048 CAAGGGGACTGCCTTCCACCGGG + Intronic
929931933 2:46263922-46263944 GACGTTGTTTTCCTTTCACCTGG - Intergenic
931497633 2:62827431-62827453 AGGGTGGACTTCCTTCCACTGGG + Intronic
934162996 2:89270104-89270126 GACATGGACTTCCTTCCTTCTGG + Intergenic
934204277 2:89912420-89912442 GACATGGACTTCCTTCCTTCTGG - Intergenic
938191914 2:129290994-129291016 GACTTTGACTTCCTTCCACTCGG - Intergenic
941880083 2:170472265-170472287 CAGGTGGACTCCCTTACACCAGG - Intronic
947495392 2:230632415-230632437 CACGTGGGGTTCCTCCCACCGGG + Intergenic
948947039 2:241225921-241225943 CACGTGTACTTCCTTCCAGCTGG + Intergenic
1170395521 20:15921463-15921485 GACGTGCTCTTCACTCCACCTGG + Intronic
1171789998 20:29514655-29514677 GACCTTGAGTTCCTTCCACGCGG - Intergenic
1171946044 20:31378333-31378355 CACCTGGACTTCCACCCACCTGG + Intronic
1173548086 20:43914656-43914678 GGCGTGGAGGTCCTTCCTCCGGG - Intergenic
1173718922 20:45236224-45236246 GGCTTGGTCTTCATTCCACCAGG - Intergenic
1174322435 20:49752533-49752555 CACATGGAGTTCCTTCTACCTGG - Intergenic
1179054426 21:37917487-37917509 GAAGTGGCTTTCCTTCCACAAGG + Intergenic
1181756405 22:25028083-25028105 GACGAGGACCTACTTCCTCCAGG + Exonic
1182482670 22:30619591-30619613 GAAGTTGAATGCCTTCCACCAGG + Intronic
1183628947 22:39021633-39021655 GCCCTGGACTTCCTTCCCTCTGG + Intronic
1184162372 22:42704684-42704706 GAGGTGGACTTCATTCCAGGAGG + Intronic
1184406474 22:44303593-44303615 GACTTGGACTTCCAGCCTCCAGG + Intronic
1185120768 22:48968619-48968641 GATGTGGACTTCCTGCCACCTGG + Intergenic
950850893 3:16061252-16061274 GAAGTGCACATCCTTGCACCAGG + Intergenic
952947389 3:38487519-38487541 CAGCTGGGCTTCCTTCCACCAGG - Exonic
954939001 3:54353774-54353796 GACTTGGGCTTCTTGCCACCTGG + Intronic
959107308 3:102079325-102079347 AACCTGGAATTCCTTCTACCAGG - Intergenic
970242034 4:14019622-14019644 GATCTAGACTTCCTTCCATCTGG + Intergenic
981300818 4:143184750-143184772 GTCGTAGACTCCCTTCCCCCCGG - Intergenic
984742589 4:183180150-183180172 CACGTGCAGTTCCCTCCACCTGG - Intronic
988809519 5:34770638-34770660 GCCTTGCAGTTCCTTCCACCAGG - Intronic
1002334206 5:178466806-178466828 GACGTGGCTGTCCTTCCACCTGG - Intronic
1002420879 5:179148563-179148585 GCCCTGGAATTCCTGCCACCAGG + Intronic
1004272684 6:14209917-14209939 GATGTGCACTTCCCTCCACCAGG - Intergenic
1006125400 6:31834660-31834682 GCCGGGGACTTTCTTCCGCCTGG + Exonic
1014551103 6:122790040-122790062 CACGGGGACTTCATTTCACCTGG + Intronic
1022838311 7:34137731-34137753 CCCTTGGACTTCCATCCACCTGG - Intronic
1029110019 7:98208981-98209003 GGCGCTGCCTTCCTTCCACCGGG - Exonic
1031987239 7:128171157-128171179 GACGTGGGCTTCCATCTACAGGG - Intergenic
1046274516 8:111939829-111939851 GAAGCAGACTTCCTTCCACCTGG - Intergenic
1049346344 8:142141123-142141145 GATGTGGACTTTCTTCCCTCTGG + Intergenic
1049778642 8:144417593-144417615 GACATGGACCTCCCTCCTCCTGG + Intergenic
1053412716 9:37926010-37926032 GACATGTACTTGCTTCCAACAGG + Intronic
1055476684 9:76669712-76669734 GAGTTGGAATTCCTTCCACAAGG - Intronic
1060941578 9:127545804-127545826 GGAATGGACTTCCTCCCACCAGG - Intronic
1062075060 9:134583435-134583457 GGCGCTGCCTTCCTTCCACCGGG + Intergenic
1199634742 X:149804694-149804716 CATGTGGACTTCCTTTCTCCAGG + Intergenic
1199639876 X:149849448-149849470 CATGTGGACTTCCTTTCTCCAGG + Intergenic