ID: 1104928771

View in Genome Browser
Species Human (GRCh38)
Location 12:132327642-132327664
Sequence CTGATTCAGCTGGAGCCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104928771_1104928775 22 Left 1104928771 12:132327642-132327664 CCTCGTGGCTCCAGCTGAATCAG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1104928775 12:132327687-132327709 CTCACCAAGCACAGCTCTGCGGG 0: 1
1: 0
2: 4
3: 35
4: 362
1104928771_1104928774 21 Left 1104928771 12:132327642-132327664 CCTCGTGGCTCCAGCTGAATCAG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1104928774 12:132327686-132327708 GCTCACCAAGCACAGCTCTGCGG 0: 1
1: 0
2: 1
3: 25
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104928771 Original CRISPR CTGATTCAGCTGGAGCCACG AGG (reversed) Intronic
901584004 1:10271545-10271567 CTGATTCAACTGGTGCCAAAGGG + Exonic
902676040 1:18009214-18009236 CTGACTGAGGTGGAGCCATGGGG - Intergenic
902954224 1:19913871-19913893 GGGATTCAGCTGGGGCCAGGTGG + Intergenic
903217038 1:21848983-21849005 CTGAATCAGCTGGGGTCACCTGG + Exonic
903395420 1:22998280-22998302 CTGATTAAACTGGACCCACCTGG - Intergenic
909822629 1:80085571-80085593 CTCATCCAGCTGTAGCCACCTGG - Intergenic
914573441 1:148941970-148941992 CTGATTCAGCTGGAGTATGGAGG + Intronic
915445204 1:155970644-155970666 CTGACTCAGCCGAGGCCACGAGG + Intronic
916501070 1:165387296-165387318 CTGAGGCAGGTGGAGCCAGGAGG - Intergenic
917539731 1:175901156-175901178 CTGATTCACCTGGAGAGAGGAGG - Intergenic
917671997 1:177281657-177281679 CTGCTTCAGCTCGAGCCTCGAGG - Exonic
918306118 1:183248480-183248502 AGGATTCAGCTGGATCCACATGG - Exonic
922029160 1:221781402-221781424 CTGATGCAGCTGGACCCTCTGGG + Intergenic
923483609 1:234407738-234407760 CTGTTTCAGCTTCAGCCACTGGG + Intronic
924878924 1:248136907-248136929 GGGACTCAGATGGAGCCACGCGG - Intergenic
1062909790 10:1205179-1205201 CTGCCTCGGCTGGCGCCACGTGG + Intronic
1063262722 10:4408484-4408506 CGGATGCTGTTGGAGCCACGAGG + Intergenic
1063505406 10:6593624-6593646 CTGATGCAGCTGGAGCTGGGTGG - Intergenic
1065142980 10:22737801-22737823 CTCATTCAGCTGCAGTCACATGG + Intergenic
1065718740 10:28603697-28603719 CTGAAGCAGGTGGATCCACGAGG + Intronic
1067329592 10:45302911-45302933 CTGTTTCCTCTGGAGCCACTTGG - Exonic
1069990167 10:72310332-72310354 CTGAATCAGCGGGAGCCTTGCGG + Intergenic
1070432846 10:76358558-76358580 CTGATAGAGCAGGAGCCAGGAGG + Intronic
1071971459 10:90911893-90911915 CTGATTCAGCTGGTCTCAGGTGG - Intergenic
1072536243 10:96365763-96365785 CTGATTCAGCTGGGGCTAGCTGG - Exonic
1074847687 10:117412737-117412759 CTGACTCTGCTTGGGCCACGTGG + Intergenic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1076727015 10:132418720-132418742 CTGACTCTGCTGCACCCACGTGG - Intergenic
1078100940 11:8329963-8329985 CTGACAGAGCTGTAGCCACGGGG + Intergenic
1081045881 11:38272454-38272476 CTGCTTCAGCTGCACCCACAAGG + Intergenic
1083682324 11:64357337-64357359 CTGCCTCAGCGGGAGCCACCTGG - Exonic
1086230927 11:84568855-84568877 CCCAGTCAGGTGGAGCCACGAGG - Intronic
1086773223 11:90795711-90795733 CTGAATCAACTGGAGTCAGGTGG + Intergenic
1089974486 11:122720613-122720635 CCCATTCAGCTGAAGCCACATGG + Intronic
1092522248 12:9287190-9287212 CTGTTTCAGCCAGAGCCCCGTGG + Intergenic
1096424455 12:51489453-51489475 CAGAGTCAGCTGGAGGCACTTGG + Intronic
1099863318 12:88246568-88246590 CTGATTGAGCTGGAGCGAAATGG - Intergenic
1103614343 12:122142625-122142647 CAGCTGCAGCTGGAGCCAAGTGG - Exonic
1104928771 12:132327642-132327664 CTGATTCAGCTGGAGCCACGAGG - Intronic
1105208889 13:18246332-18246354 CTGCTACAGCTGGAGCCCCTGGG - Intergenic
1105676036 13:22672574-22672596 CAGATTCAGCTGGATTCACTGGG - Intergenic
1106101086 13:26695570-26695592 CTGTCCCAGCTGGGGCCACGGGG - Intergenic
1106435726 13:29721560-29721582 CTGATCCACCTGGAGCCTCTAGG - Intergenic
1107604905 13:42048181-42048203 TTTATTCAGCTGGAACCGCGCGG + Intronic
1107636233 13:42395248-42395270 CTGATCCAGGTGGAGCCCAGAGG + Intergenic
1109061646 13:57629583-57629605 CTCATTCAGATGGGTCCACGCGG + Intergenic
1110093936 13:71491453-71491475 CTCATACAGCTGAAACCACGAGG - Intronic
1112749849 13:102571164-102571186 CTGCTTCAGCTGGAGCACAGAGG + Intergenic
1120071468 14:80108160-80108182 CTGGGTCAGCTGGACCCATGGGG + Intergenic
1120978477 14:90270558-90270580 CTAAATCACCTGGAGCCACAAGG + Exonic
1120996911 14:90424142-90424164 CAGATTCAGCTGGGGCCCTGGGG + Intergenic
1121016761 14:90553608-90553630 CTGAGTCTTCTGGAACCACGTGG + Intronic
1121422488 14:93825167-93825189 CTGACTCAGCTGGCGCCGCCCGG + Intergenic
1127810454 15:62560875-62560897 CCGAGGCAGCTGGAGCCAGGAGG + Intronic
1129185355 15:73902838-73902860 CTGATTCAGACTGAGCCACCAGG - Intergenic
1129671798 15:77611782-77611804 CTGCTTCAGCTGGAACCAGGAGG + Intergenic
1129710706 15:77819145-77819167 CTGATTGGGCGGGAGCCTCGGGG - Intronic
1130665318 15:85864474-85864496 CTGATTCAGCAGGTCCCAGGTGG - Intergenic
1130834789 15:87639364-87639386 CTGATCCAACTGGAGCTACTTGG + Intergenic
1135976251 16:27110434-27110456 CTAATCCAGCCGGAGCCATGAGG + Intergenic
1141883301 16:86874207-86874229 CTGATTCTGTTAGAGCCACAGGG - Intergenic
1144691714 17:17270563-17270585 CTGAATGAGGTGGAGGCACGGGG - Intronic
1148892860 17:50820385-50820407 CTCATTCATCGGGAGCCACCAGG - Intergenic
1151383196 17:73739683-73739705 CTGATCCAGCTGAAGCCCAGTGG + Intergenic
1152220623 17:79063220-79063242 GTAGTTCAGCTGGAGCCAGGTGG + Intergenic
1152282363 17:79392508-79392530 CTGTTCCTGCTGGAGCCACGGGG + Intronic
1152490998 17:80633631-80633653 CTGATTCAGCTGGCGCCTGCTGG + Intronic
1152537886 17:80960952-80960974 CTGATGAAGCTGGAGGCACAAGG - Intronic
1152841824 17:82574242-82574264 CTTAATTAGCTGGAGCCACGAGG - Intronic
1160699548 19:499151-499173 CTCATTCTGCTGCAGCCACACGG + Intronic
1161451115 19:4345929-4345951 CTGGTGCAGCCGGAGCCAGGTGG - Exonic
1161595794 19:5150469-5150491 CTGAGTCACCCGGAGCCACCAGG - Intronic
1161756420 19:6137442-6137464 CTCACTCTGCTGCAGCCACGTGG - Intronic
1162726794 19:12694813-12694835 CTGAGTCAACGGAAGCCACGTGG + Exonic
924998302 2:384140-384162 CTGATGCAGCAGGAGCCGGGTGG + Intergenic
925259457 2:2517204-2517226 CTGTGCCAGCTGGAGCCAGGAGG + Intergenic
926314381 2:11698451-11698473 CTGAAACTGTTGGAGCCACGTGG - Intronic
926959108 2:18334061-18334083 CTGATTAAGATGGAGCCACATGG - Intronic
932186833 2:69704550-69704572 CTGTGTCAGCTGGAGCAACAGGG + Intronic
934079863 2:88458623-88458645 GTTAATCAGCTGGAGCCAAGGGG - Intergenic
934700010 2:96431394-96431416 CTGGTCCAGCTGTAGCCTCGCGG + Intergenic
934918483 2:98321054-98321076 CTGTTTCAGCTTCAGCCATGAGG + Intergenic
935672035 2:105564202-105564224 CTGATTCAGCAGGAGGGACTGGG + Intergenic
941316992 2:164005474-164005496 CAGATTCAGCTGGAGGAATGGGG + Intergenic
943813683 2:192223500-192223522 CAGGTGCAGCTGGAACCACGAGG + Intergenic
946190938 2:218007661-218007683 CTGACTCTTCTGGAGCCACTAGG - Intergenic
1171290058 20:23978054-23978076 CTGCTACAGCTGGAGCCCCTGGG - Intergenic
1171458575 20:25285781-25285803 CTGATACAGCTGGGGACAGGAGG - Intronic
1172560287 20:35881906-35881928 TTGATTCTGCTGCAGCCACATGG + Intronic
1173880125 20:46406067-46406089 CTGAGCCAGCAGGATCCACGGGG + Intronic
1175605607 20:60310066-60310088 CTGATTCATATGGAGCCCCCAGG - Intergenic
1184054157 22:42033218-42033240 CTGGTCCAGCTGCAGCCTCGTGG - Intronic
950941410 3:16896887-16896909 CTGATTCAATTGCAGCCAGGTGG - Intronic
951092450 3:18590056-18590078 CTGATTGAGCACCAGCCACGTGG + Intergenic
953746747 3:45580334-45580356 CTGAATCAGATGGAGCCACAAGG - Intronic
954537611 3:51373299-51373321 CAGATTCAGCTGGAGCCCATGGG + Intronic
955016032 3:55070246-55070268 CTGATTCAGTTGGAGTGATGAGG + Intronic
956017726 3:64901706-64901728 CTGAATCAGCAGGAGCAACCAGG - Intergenic
961173453 3:124815495-124815517 CTGACTCAGCAGGAGGCAAGCGG + Intronic
967968736 3:194984155-194984177 CTGATGCAGCTGGAGGCTGGGGG + Intergenic
967979431 3:195056780-195056802 CTGACTCAGCTAGAGTCAAGAGG + Intergenic
971974851 4:33671493-33671515 CTGAGCCAGCAGGAGCCACTGGG - Intergenic
977249604 4:94675190-94675212 CTGATTCAGCTGGAGTGGAGTGG + Intergenic
984062100 4:175002457-175002479 TAGATTCTGCTGGAGCCATGTGG - Intergenic
985070015 4:186158531-186158553 CTGATGCAGCTGTGGCCAAGGGG + Intronic
986192390 5:5509514-5509536 TGGCTGCAGCTGGAGCCACGTGG - Intergenic
986511802 5:8514986-8515008 CTCATTCTGCTGTAGCCATGTGG + Intergenic
987999482 5:25330670-25330692 CTGGTGCAGCTGCAGCCACCCGG + Intergenic
992941100 5:81762651-81762673 CTGAATCAGCTGTAGCAATGGGG + Intergenic
996096105 5:119400772-119400794 CTGTTTTTGCTGGAGCCAAGAGG - Intergenic
999201697 5:149821222-149821244 CTTTTTCAGCTGGAGCCTAGAGG + Intronic
999242750 5:150137116-150137138 CTCATTCTGCAGGAGCCAGGTGG - Intronic
999877329 5:155822307-155822329 CTGATTCAGCTGGGGGCAAGAGG - Intergenic
1001607245 5:172970346-172970368 CTGCTTCACCTGGCTCCACGGGG + Intergenic
1009582436 6:65553206-65553228 CTGTTTCAGATGAAGCCACTTGG - Intronic
1010471931 6:76238789-76238811 CAAATTCAGATGGAGCCACAAGG + Intergenic
1011807560 6:91089299-91089321 CTCATTCAGCTCCAGCCACTTGG + Intergenic
1016632514 6:146249405-146249427 CTGTTTGAGCTGGAACCGCGGGG - Intronic
1016893536 6:149031245-149031267 CTGGTTCAGCTGTAGCTACTGGG + Intronic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1018291005 6:162292636-162292658 CTGAATCAGCTGGAGGAAGGTGG + Intronic
1018792994 6:167163808-167163830 CCGATCCAGGTGGAGCCAGGCGG - Intronic
1020041363 7:5005125-5005147 CTGTGTCAGCTGGAGCAACAGGG + Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1024095638 7:45980346-45980368 CAGCTGCAGCTGAAGCCACGTGG - Intergenic
1025249585 7:57343029-57343051 CTCATTCTGCTGCAGCCACACGG + Intergenic
1027177274 7:75912631-75912653 CTGTTCCAGTTGGGGCCACGTGG - Intronic
1027867207 7:83663168-83663190 CTGAGTCTGCAGGAGGCACGAGG - Intergenic
1027954070 7:84857456-84857478 CTGGTCCAGATGGAGCCATGTGG - Intergenic
1027999970 7:85481428-85481450 CTGAATCAGTTGGAGGCACATGG + Intergenic
1032705020 7:134414154-134414176 CTCACTCTGCTGGAGCCACATGG - Intergenic
1033434158 7:141317390-141317412 CTGATGCACCTGCAGCCAGGTGG - Intronic
1034456910 7:151175587-151175609 GTGATTCAGCTGGAACCGTGGGG + Intergenic
1035174729 7:157042181-157042203 CTGGAACAGCTGGAGCCACAGGG - Intergenic
1036487276 8:9190795-9190817 CTGATTTGTCTGGAGCCCCGTGG + Intergenic
1037164888 8:15815354-15815376 CTGAGTCAGCTGGAGTCCCTGGG + Intergenic
1044698221 8:94944186-94944208 CTGAATCAGCTAAAGCCACTGGG + Intronic
1044761739 8:95525181-95525203 CTGATTAAACTAGAGCCACGGGG + Intergenic
1045371478 8:101528723-101528745 CTGGTTCAGCTGGAACCAGAAGG - Intronic
1046564496 8:115881903-115881925 CTGCTTTAGCTGCAGCCACCTGG - Intergenic
1046587525 8:116166291-116166313 CTGATTCTTCTGGAGTCAGGGGG + Intergenic
1047254970 8:123207600-123207622 CTGCTCCAGCTGCAGCCGCGTGG - Exonic
1047403057 8:124562173-124562195 CTGCTCCAGCTGGAACCACTGGG + Intronic
1049374868 8:142284577-142284599 CTGATTCTGCAGGTGCCACCTGG - Intronic
1060877941 9:127096551-127096573 CAGCCCCAGCTGGAGCCACGAGG - Intronic
1195127618 X:101823341-101823363 CTGGTCCAGCTGCAGCCTCGTGG + Intergenic
1195760675 X:108243063-108243085 CTGATTCAGCGGGAGGCTCAAGG + Intronic