ID: 1104929163

View in Genome Browser
Species Human (GRCh38)
Location 12:132329251-132329273
Sequence GCTGAAGCCCAGGCCCGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 444}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104929163_1104929174 8 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929174 12:132329282-132329304 CGGGGACCATGAGCCGCCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 75
1104929163_1104929173 7 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929173 12:132329281-132329303 TCGGGGACCATGAGCCGCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 65
1104929163_1104929183 24 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929183 12:132329298-132329320 CCCGGGGCTGCGGGGGCTGCGGG 0: 1
1: 4
2: 18
3: 157
4: 1019
1104929163_1104929185 25 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929185 12:132329299-132329321 CCGGGGCTGCGGGGGCTGCGGGG 0: 1
1: 2
2: 18
3: 137
4: 861
1104929163_1104929176 14 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929176 12:132329288-132329310 CCATGAGCCGCCCGGGGCTGCGG 0: 1
1: 0
2: 2
3: 21
4: 187
1104929163_1104929179 17 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929179 12:132329291-132329313 TGAGCCGCCCGGGGCTGCGGGGG 0: 1
1: 0
2: 4
3: 30
4: 226
1104929163_1104929186 30 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929186 12:132329304-132329326 GCTGCGGGGGCTGCGGGGCTCGG 0: 1
1: 0
2: 11
3: 90
4: 924
1104929163_1104929177 15 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929177 12:132329289-132329311 CATGAGCCGCCCGGGGCTGCGGG 0: 1
1: 0
2: 1
3: 23
4: 180
1104929163_1104929171 -10 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929171 12:132329264-132329286 GGGCTTCAGCTTCGGCTTCGGGG 0: 1
1: 0
2: 1
3: 10
4: 95
1104929163_1104929172 6 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929172 12:132329280-132329302 TTCGGGGACCATGAGCCGCCCGG 0: 1
1: 0
2: 0
3: 5
4: 37
1104929163_1104929181 23 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929181 12:132329297-132329319 GCCCGGGGCTGCGGGGGCTGCGG 0: 1
1: 0
2: 12
3: 143
4: 1194
1104929163_1104929178 16 Left 1104929163 12:132329251-132329273 CCCGCCCGGGCCTGGGCTTCAGC 0: 1
1: 0
2: 6
3: 53
4: 444
Right 1104929178 12:132329290-132329312 ATGAGCCGCCCGGGGCTGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104929163 Original CRISPR GCTGAAGCCCAGGCCCGGGC GGG (reversed) Intronic
900112442 1:1014162-1014184 GCCGGGGCCCAGGCCCTGGCTGG - Exonic
900127273 1:1074127-1074149 GGTGAAGCACAGGCCGGGCCGGG - Exonic
900347329 1:2215969-2215991 GGTGATGCCCAGGCCGCGGCTGG + Intergenic
900408989 1:2504444-2504466 GCTGCGGCCCAGGCCCAGGCTGG - Exonic
900564423 1:3325333-3325355 GCTGATGCTCAGGCCTGAGCTGG - Intronic
900623517 1:3598053-3598075 GCTGCAGGGCAGGCCCGGGGCGG - Intronic
900750990 1:4397321-4397343 GCTGGAGCCAGGGCCAGGGCAGG + Intergenic
901002776 1:6156848-6156870 CCAGATGACCAGGCCCGGGCTGG + Intronic
901026697 1:6282170-6282192 GATGGAGCCCAGGCCGGGGAGGG - Intronic
901069895 1:6511859-6511881 CAGGAAGCCCAGGGCCGGGCAGG + Intronic
901190509 1:7407316-7407338 GGTGCAGCCCAGGCTCGGGGAGG + Intronic
902045878 1:13523985-13524007 GCTCAAGCCCGGGCCTGGGAGGG + Intergenic
902391885 1:16111724-16111746 GATGCAGCCAAGGACCGGGCAGG - Intergenic
902478851 1:16701373-16701395 GCAGACGCCAGGGCCCGGGCCGG - Intergenic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
902871749 1:19317787-19317809 GATCAAGCCCAGGCCCACGCTGG - Exonic
902916683 1:19644096-19644118 GCCGAAGCTCAGCCCGGGGCGGG + Intronic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
903260625 1:22129905-22129927 GCTGGAGCTCAGGCCTGGTCCGG - Intronic
904038687 1:27572038-27572060 GCTGAAGGCCAGGCTGGTGCAGG - Intronic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
904254311 1:29244921-29244943 GATGAAGTCCAGGCCTGGGAGGG + Intronic
904300184 1:29549166-29549188 GCTTGAGCCCAGGGCCAGGCAGG + Intergenic
904306601 1:29594077-29594099 GCTGAGACCCAGGCCCAGGAAGG + Intergenic
904744745 1:32703540-32703562 CCTGAAGCCCAGGTCTGGGAAGG - Intronic
905454038 1:38075445-38075467 GGTGTGGCCCAGGCCAGGGCTGG - Intergenic
905730971 1:40299487-40299509 GCTGAAGCCAAGCCTTGGGCAGG - Intergenic
907251795 1:53144365-53144387 GCTAAAGGCCAGGTCTGGGCTGG - Intergenic
907333006 1:53683648-53683670 GCAGAAGACCTGGCACGGGCAGG + Intronic
910825642 1:91404602-91404624 GCTGAGGCGCTGGCGCGGGCCGG + Intronic
912438876 1:109683127-109683149 GCAGAAGTCCAGGCCCTGTCGGG + Intronic
912441398 1:109701572-109701594 GCAGAAGTCCAGGCCCTGTCGGG + Intronic
913201990 1:116502389-116502411 GAAGAAGCTCAGGCCCGGGCAGG + Intergenic
915005443 1:152630686-152630708 GCTGTACCCCAGCCCAGGGCAGG - Intergenic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
915349672 1:155216510-155216532 GGTGAAGCCCAGGCACTGGAAGG + Intergenic
915352889 1:155237467-155237489 GGTGAAGCCCAGGCACTGGAAGG + Exonic
915525885 1:156475998-156476020 GCCAAGGCCCAGGCCCAGGCTGG - Intronic
916066630 1:161141209-161141231 GGTGAAACCCAGGCCCCGACAGG - Intergenic
917222625 1:172748276-172748298 GCTGAAGCCCGCGGCGGGGCAGG + Intergenic
917263071 1:173190491-173190513 CCTGCAGCCCAGTCCCTGGCAGG - Intronic
917929348 1:179813017-179813039 GCTGCAGCCCTGGGCTGGGCCGG - Intronic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920220732 1:204398449-204398471 GCTGTCGCCCAGGCCTAGGCTGG - Intergenic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
920560865 1:206937407-206937429 GCTAAAGCCCGAGCCCGAGCTGG - Exonic
922810141 1:228410787-228410809 GCTGAGGCCAAGGTGCGGGCAGG - Intronic
923463877 1:234231449-234231471 GCGGAGGCCCAGGCACCGGCCGG + Exonic
923537347 1:234863357-234863379 CCTGCAGCCCAGGCTGGGGCTGG - Intergenic
923605529 1:235439525-235439547 TCTGTCGCCCAGGCCCAGGCTGG + Intronic
923650325 1:235867147-235867169 GCTGCAGCCGGGGCCCGGTCTGG + Intronic
924037137 1:239949220-239949242 GCAGAGGAGCAGGCCCGGGCAGG - Intergenic
1063713620 10:8505658-8505680 GCTAAAGCCCAGGACCAGCCGGG - Intergenic
1065605587 10:27414214-27414236 GCCCAAGCCCAGGCCGGGGCCGG - Exonic
1065605590 10:27414220-27414242 GGTGGAGCCCAAGCCCAGGCCGG - Exonic
1065880507 10:30033779-30033801 CCTGCAGCCCAGGCCCCAGCAGG - Intronic
1065965258 10:30765699-30765721 GCTGCAGCCCAGGCCCTAACTGG + Intergenic
1066659052 10:37721524-37721546 GCAGACACCCAGGCCTGGGCTGG + Intergenic
1066959165 10:42204179-42204201 TCTGTCGCCCAGGCCCAGGCTGG + Intergenic
1067362404 10:45594671-45594693 GCCGAGCCCCCGGCCCGGGCAGG - Intronic
1067438377 10:46294451-46294473 GCTGGAGCCCAGGCCCAGCAGGG + Intronic
1067444206 10:46330482-46330504 TCTGTCGCCCAGGCCCAGGCTGG + Intergenic
1068703295 10:60043732-60043754 GCTGAAGGCCAAGCCCTGGGTGG + Intronic
1070282370 10:75059033-75059055 GCCCAGACCCAGGCCCGGGCAGG - Intergenic
1070955148 10:80458803-80458825 GGTGGAGCGCAGGCCCTGGCAGG + Intronic
1072190664 10:93074164-93074186 GCAGAAGCCCAGAGCCGCGCCGG - Intronic
1073012631 10:100373316-100373338 GCTGCCAGCCAGGCCCGGGCAGG - Intergenic
1073121868 10:101126821-101126843 GCTGGGGCCAGGGCCCGGGCTGG - Intronic
1073287635 10:102398307-102398329 GCTAGGGCCCGGGCCCGGGCTGG + Intronic
1073292766 10:102421519-102421541 GCTGAAGCCCCGCCCCTGCCTGG + Intronic
1074162766 10:110847498-110847520 GCTGCAGCCCAGGGCCAGGATGG - Intergenic
1074183516 10:111082627-111082649 GCTGGAGCCCAGGCATGGGTGGG + Intergenic
1074277910 10:112022469-112022491 CCTGAAGCCTTGGCCTGGGCTGG - Intergenic
1074533107 10:114310505-114310527 GCTGAAGCCAGGGCCCCTGCAGG + Intronic
1074546278 10:114404299-114404321 TCTTAGGCCCAGGTCCGGGCTGG + Intronic
1074843185 10:117375090-117375112 GCGGAAGCCCTCGCCCGCGCGGG + Exonic
1075559121 10:123455818-123455840 GATGCAGAGCAGGCCCGGGCGGG + Intergenic
1075572625 10:123556965-123556987 GCTGAGCCCCAGGCCCGGGAAGG + Intergenic
1075572783 10:123557635-123557657 GCTGAGCCCCAGGCCAGGGCAGG + Intergenic
1075726574 10:124613605-124613627 GCTGAAGTCAGGGCCCAGGCAGG - Exonic
1076236957 10:128870987-128871009 GCTGAAGCCCAGGGCCTGCATGG - Intergenic
1076852559 10:133100167-133100189 GCCCAGGCCCAGGCCCAGGCCGG - Intronic
1077034370 11:487717-487739 GCCCAAGCCCAGGCAGGGGCGGG - Intronic
1077068703 11:657249-657271 GCTGATTCCCGGGCCAGGGCAGG + Intronic
1077100320 11:819622-819644 GCTGGAGCCGGGGGCCGGGCAGG - Exonic
1077115059 11:880395-880417 GCGGGAGCCCAGGCCTGTGCTGG + Intronic
1077190679 11:1254898-1254920 GCAGCAGCCCTGGCCGGGGCAGG - Intronic
1077236161 11:1482927-1482949 GCGAAGGCCCAGGCCTGGGCAGG + Intronic
1077236965 11:1486510-1486532 CCTGAAGACCAAGCCCGGCCCGG - Exonic
1077285383 11:1763201-1763223 GCACAACCCCAGGCCCGGGGTGG + Intronic
1077479148 11:2805061-2805083 GCAGAAACTCAGGCCCGGGATGG - Intronic
1078010498 11:7569767-7569789 GATGAAGCTGAGGCCCTGGCTGG + Intronic
1078110037 11:8385001-8385023 GGGGAAGGCCAGGCCTGGGCTGG - Intergenic
1078801117 11:14644503-14644525 GCCGCAGCTCCGGCCCGGGCCGG - Exonic
1078855634 11:15204604-15204626 GGTGAAGACCAGGCACAGGCCGG + Intronic
1081529454 11:43947965-43947987 GCTGAAGCCCAGGCAGGGAGGGG - Intergenic
1081616816 11:44596168-44596190 GGGGAAGCCCAAGCCCGGCCTGG - Intronic
1081793304 11:45804157-45804179 ACTGAAGCCGGGTCCCGGGCGGG + Intronic
1081864576 11:46352497-46352519 CCTGAGGCCCAGGCCCAGCCAGG + Intronic
1082001469 11:47395546-47395568 GCTGAAGCCCACTCCCGGGGAGG + Intergenic
1083658587 11:64241845-64241867 GCGGAAGCACAGGGCCAGGCTGG + Exonic
1083710176 11:64543079-64543101 GATGATGCCCAAGCCCGGCCGGG + Intergenic
1083743057 11:64721338-64721360 GATTCAGCCCAGGCCTGGGCTGG + Intronic
1083921937 11:65786083-65786105 GCTGAACCTCAGCCCTGGGCAGG + Intergenic
1083977286 11:66133548-66133570 TCTGAAGACCATGCCCAGGCTGG + Intronic
1084009404 11:66339219-66339241 GCTGGAGAGCAGGCCCAGGCAGG - Intronic
1084114082 11:67031741-67031763 GGTGGAGCCCATGCCCGGGGTGG - Intronic
1084660765 11:70545058-70545080 GCAAGAGCCCAGGCCAGGGCAGG + Intronic
1084891711 11:72239980-72240002 GCTGGGGCTCAGGCGCGGGCTGG + Exonic
1085020697 11:73205045-73205067 CCCCAAGCCCAGGCCAGGGCAGG - Intergenic
1085308098 11:75499870-75499892 GTTGAAGCTCAGGGCTGGGCGGG - Intronic
1085425939 11:76404676-76404698 GAGGAAGCCCAGGCCATGGCAGG + Exonic
1087014691 11:93543474-93543496 GCGGGAGCCGAGGCCCGGGCGGG - Exonic
1088437121 11:109826708-109826730 GCTGAAGCCCAGGTCAGAGATGG + Intergenic
1088911676 11:114196990-114197012 GCTGATGCCCAGGCCCCCACAGG - Intronic
1089045935 11:115502900-115502922 GCGGAGCCCCAGGCCCGGGCGGG - Intronic
1089560203 11:119339934-119339956 GCCGAAGCTCAGGCAGGGGCGGG - Intronic
1089962255 11:122626423-122626445 GCTGGAGCCCTGGCTCGTGCTGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092780160 12:11978782-11978804 GCTGCAGCCCAGCCCTGGGATGG - Intergenic
1096650819 12:53061140-53061162 GCTGTTGCCCCGGCCCGGGCAGG - Exonic
1096679761 12:53247820-53247842 GCTGAAGCCCAGGACTGGGCTGG + Intergenic
1096684143 12:53276774-53276796 GCTCGTGCCCAGGCCCCGGCTGG - Exonic
1097102913 12:56601908-56601930 GCTGAAGCTGAGGCTGGGGCTGG + Exonic
1097875282 12:64637457-64637479 TCTGTTGCCCAGGCCCAGGCTGG + Intronic
1100243099 12:92729484-92729506 GCTGAAGCCCAGGAGTGGGGTGG - Intronic
1102004653 12:109581439-109581461 GCTGGAGCCCAAGCCCGCCCCGG - Exonic
1102949983 12:117025033-117025055 GCAGCAGCCCAGCCCAGGGCTGG + Intronic
1104746604 12:131214944-131214966 GCTGAAGCGGAGGCCTGGGAGGG - Intergenic
1104824382 12:131698375-131698397 GTTGAAACCCAGGCGCTGGCAGG + Intergenic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1104975396 12:132549838-132549860 CCTCCAGCCCAGGCCCGGGCAGG - Intronic
1105345178 13:19564950-19564972 GCAGAAGCCCAGGCCTCGGCTGG + Intergenic
1105578775 13:21675078-21675100 GCGGAAGCCCCGGCCCAGGTTGG + Intronic
1106331287 13:28741907-28741929 TCTGTTGCCCAGGCCCAGGCTGG + Intergenic
1107466528 13:40655670-40655692 GCTGTCGCCCAGGCTCAGGCCGG + Intronic
1108559937 13:51633205-51633227 GCTGGAGGCCAGGCCAGTGCTGG - Intronic
1110281704 13:73701185-73701207 GCAGCAGCCCAGGCCCTGGGAGG - Intronic
1111129513 13:83956191-83956213 ACTGAAGCCCAGGCCGGGTGCGG - Intergenic
1112385113 13:98932015-98932037 CCTGAAGCCCAGGCCGGGCATGG - Intronic
1113899942 13:113791151-113791173 GCTGCAACCCAGCCCTGGGCAGG - Intronic
1114505838 14:23212609-23212631 TCTGTCGCCCAGGCCCAGGCTGG + Intronic
1116886959 14:50231387-50231409 GCCGTAGCCTCGGCCCGGGCGGG - Exonic
1119386635 14:74261438-74261460 GTGGAAGCCCAGGCCCAGCCAGG - Exonic
1119480616 14:74955608-74955630 CCTGAAACCCAGGCGCGGACCGG - Exonic
1119646954 14:76355004-76355026 GATAAAGCCCAGGACCGGCCGGG - Intronic
1121439881 14:93941940-93941962 CCTGAAGCCCAGGCTTGGGGTGG + Intronic
1121729894 14:96179223-96179245 GCTGAAGCCCAGGACATGCCAGG - Intergenic
1122148115 14:99706232-99706254 GCTGGTGCCCAGGGCAGGGCAGG + Intronic
1122741153 14:103872194-103872216 GCGGCAGGCAAGGCCCGGGCTGG - Intergenic
1122970181 14:105149347-105149369 GCCTAGGCCCAGGCCCAGGCCGG + Intronic
1123027999 14:105437666-105437688 GCTGAATCCCAGGCCTGTGCGGG + Intronic
1123114191 14:105886533-105886555 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114210 14:105886597-105886619 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114234 14:105886677-105886699 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114254 14:105886742-105886764 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123116408 14:105896141-105896163 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123120643 14:105914842-105914864 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123932895 15:25180391-25180413 GCTGAAGCTCAGGCCCTTCCTGG + Intergenic
1123935330 15:25191301-25191323 GCTGAAGCTCAGGCCCTTCCTGG + Intergenic
1123945709 15:25237883-25237905 GCTGAAGCTCAGGCCCTTCCTGG + Intergenic
1124706967 15:31974405-31974427 TCTGAAGCCCAGGCCCTGTCTGG + Intergenic
1126009487 15:44288958-44288980 GCAGAAGCCCAGGCCTCGGCTGG - Exonic
1126802648 15:52313708-52313730 AATGAAGCCCAGGCCGAGGCTGG + Exonic
1127303274 15:57678330-57678352 TCTGTTGCCCAGGCCCAGGCTGG - Intronic
1127359298 15:58230817-58230839 GCTCCAGCCCAGCCCCAGGCAGG + Intronic
1127803945 15:62501348-62501370 GCTGAGGCCAAGGGCAGGGCTGG + Intronic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1128156638 15:65395705-65395727 GCACCAGCGCAGGCCCGGGCGGG - Intronic
1128205739 15:65850331-65850353 TCTGCTGCCCAGGCCCAGGCTGG + Intronic
1128325218 15:66719709-66719731 GCTTAGTCCCAGGCCCAGGCAGG + Intronic
1128999341 15:72319812-72319834 GCTGAAACCCAGGCGCGGGCCGG + Exonic
1129198192 15:73983416-73983438 GCTGCAGTCCAGGCCCGTGCTGG - Exonic
1129261685 15:74372100-74372122 ACATAAGCCCTGGCCCGGGCAGG - Intergenic
1129271514 15:74421631-74421653 GCGGGAGCCCAGGCTGGGGCTGG - Intronic
1129539630 15:76339667-76339689 GCCGAAGCCCAAGGGCGGGCAGG + Intronic
1129667210 15:77586018-77586040 GCAGATGCCCAGGCCCCGGTGGG + Intergenic
1129786043 15:78310845-78310867 TCTGTTGCCCAGGCCCAGGCTGG + Intergenic
1130115359 15:81001171-81001193 GCAGGAGCCGGGGCCCGGGCCGG + Exonic
1130147108 15:81282642-81282664 GCCGATGCCCAGGCCCACGCCGG - Exonic
1132092184 15:98955760-98955782 CCTGAAGGCCAGACACGGGCAGG + Intronic
1132366878 15:101264284-101264306 GCTGAAGCCCAGCCCAGGCCTGG + Intergenic
1132370686 15:101295608-101295630 GCCAAGGCCCAGGCCCGGGGCGG - Intergenic
1132514962 16:361958-361980 GCTGAAGGCCAGGCCCAGTCTGG + Intergenic
1132584625 16:700819-700841 GCTCAGGGCCAGGCCCGGGCTGG + Intronic
1132616769 16:844900-844922 GCCGAAGCCCAGTCCCGGAGAGG - Intergenic
1132838222 16:1965287-1965309 GGTGAAACCCAGGCCCCGACAGG + Intergenic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132956975 16:2599468-2599490 GCAGCAGCCAAGGCCCAGGCAGG - Exonic
1132969326 16:2677921-2677943 GCAGCAGCCAAGGCCCAGGCAGG - Intergenic
1133056491 16:3147934-3147956 GCCCAAGCCCAGGCCCTGGAAGG - Intronic
1134149713 16:11796627-11796649 GGTGCAGCCCTGGGCCGGGCGGG - Intronic
1136008156 16:27345163-27345185 ACTGAGGCCCAGGCAGGGGCAGG - Intronic
1136460418 16:30407259-30407281 GGAGAGGCCCAGGCCGGGGCGGG + Intergenic
1136721540 16:32322652-32322674 GCTAAAGCCCAGGTGCTGGCTGG - Intergenic
1136775278 16:32868503-32868525 GCTGTAGCCCAGTCAGGGGCAGG + Intergenic
1136839920 16:33528940-33528962 GCTAAAGCCCAGGTGCTGGCTGG - Intergenic
1136884461 16:33923104-33923126 GGTGATGCCCATCCCCGGGCTGG + Intergenic
1136895337 16:33993009-33993031 GCTGTAGCCCAGTCGGGGGCAGG - Intergenic
1137877026 16:52006754-52006776 TCTGAAGGCAAGGCCAGGGCAGG + Intronic
1138490452 16:57373280-57373302 ACTGAAGCCCAGGACCTGGTAGG + Intronic
1138943638 16:61820945-61820967 TCTGATGCCCAGGCCCAGGATGG - Exonic
1139440481 16:66964165-66964187 GCTGAAGCCCAGGTTCCAGCAGG + Intronic
1140480759 16:75261688-75261710 CCTGCAGGCCATGCCCGGGCAGG + Intronic
1141315957 16:82962637-82962659 TCTGAACCCCTGGCCAGGGCAGG + Intronic
1142120021 16:88382653-88382675 GCTGGAGCGCAGGCCAGGGATGG + Intergenic
1142157838 16:88540671-88540693 GCAGATTCCCAGGCCCTGGCCGG - Intergenic
1142375976 16:89707354-89707376 GCTGCACCCCAGGCCCCAGCCGG + Exonic
1203004892 16_KI270728v1_random:195118-195140 GCTAAAGCCCAGGTGCTGGCTGG + Intergenic
1203077696 16_KI270728v1_random:1130612-1130634 GCTGTAGCCCAGTCGGGGGCAGG + Intergenic
1203136442 16_KI270728v1_random:1731237-1731259 GCTAAAGCCCAGGTGCTGGCTGG + Intergenic
1203150088 16_KI270728v1_random:1829225-1829247 GCTAAAGCCCAGGTGCTGGCTGG - Intergenic
1142637698 17:1268324-1268346 TTTGAAGCCCAGGCCCCGCCCGG + Intergenic
1142753127 17:2000076-2000098 GCAGCAGCCCTGGCCCAGGCAGG - Intronic
1143108359 17:4540588-4540610 GCTGAGGCCCAGGAAGGGGCAGG - Intronic
1143450888 17:7036168-7036190 ACTGAAGACCTGGCCCGCGCTGG - Exonic
1143487668 17:7263352-7263374 GTCCAAGCCCAGGCCCGGGAGGG - Intronic
1143731977 17:8886571-8886593 GCTGAAGCCCAGGCCCTGGAGGG - Exonic
1143974262 17:10818565-10818587 GCTAAAGCCCAGGTACAGGCAGG - Intergenic
1144221575 17:13104674-13104696 GTTGAATCCCAGGTCTGGGCAGG - Intergenic
1144828707 17:18120452-18120474 GCCGAAGCCCAGGCCCCGGTGGG - Exonic
1144840857 17:18184678-18184700 GCAGAAGCGCGGGCCCGGCCAGG + Exonic
1146001315 17:29132169-29132191 GCTGGAGCCCAGGAGCTGGCTGG + Intronic
1146691877 17:34882437-34882459 ACTGTAGACCAGGCCTGGGCTGG - Intergenic
1147145631 17:38482845-38482867 GGTGATGCCCATCCCCGGGCTGG - Intronic
1147422363 17:40328206-40328228 GTTGAAGACCAGGCCTGGGAAGG - Intronic
1147459268 17:40557988-40558010 GCTGCAGCCCAGGCTCCGGGGGG + Intronic
1147743094 17:42679688-42679710 GCGGAAGCGCAGGCCCAGGAAGG + Exonic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1148178420 17:45586374-45586396 GCTGCTGCCCAGCCCCGGACCGG + Intergenic
1148511393 17:48173148-48173170 TCTGTTGCCCAGGCCCAGGCTGG - Intronic
1148695617 17:49556431-49556453 CCTGTAGCCCAGGCCCTGGGTGG - Intergenic
1148930078 17:51120757-51120779 GCTGGAGCCCGGGCCGGGGCTGG + Exonic
1149467151 17:56888967-56888989 GCTGTAGACAAGGCCAGGGCTGG - Exonic
1149467794 17:56893427-56893449 GCTGCAGCCCAGGGCTGGTCTGG + Intronic
1150314643 17:64158348-64158370 GATGAAGCCGAGGCCCTGCCAGG + Intronic
1151191332 17:72400181-72400203 GTTGAAGCCAAGGGCAGGGCCGG + Intergenic
1151302731 17:73239809-73239831 TCTGAAGCTCAGGCCAGGCCTGG - Intronic
1151516525 17:74599634-74599656 GATGGAGCCCAGGCCAGGCCTGG + Intergenic
1151671861 17:75575296-75575318 GCTCCAGCCCTGGCCTGGGCCGG + Intergenic
1151812573 17:76453080-76453102 GCTGGAGCCGGGGCCTGGGCTGG + Exonic
1152184150 17:78843654-78843676 GCGGCAGCCCAGGCCCGGGCAGG + Intergenic
1152186323 17:78858411-78858433 TCTGTCGCCCAGGCCCAGGCTGG - Intronic
1152460770 17:80441283-80441305 GCTGAAGTCAAGGCTGGGGCCGG + Intergenic
1152480050 17:80545009-80545031 GCTGAAGGCCAGGACCAGCCAGG + Intronic
1152830905 17:82496615-82496637 GCAGGAGCCCTTGCCCGGGCAGG - Intergenic
1153904929 18:9652854-9652876 GCTAAAGCCAAGGTGCGGGCAGG + Intergenic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1154060523 18:11055792-11055814 GCTGCAGCCCAGGCCCAGCGCGG - Intronic
1157222683 18:45838820-45838842 GCTGTTGCCCAGGGCCGGGCCGG - Exonic
1157248268 18:46072102-46072124 GCTCAGGACCCGGCCCGGGCGGG - Intronic
1157887684 18:51384394-51384416 GCAGGAGCCCAGGCCATGGCAGG + Intergenic
1160318347 18:77868353-77868375 AATGAAGCTCAGGCCAGGGCAGG + Intergenic
1160660520 19:296150-296172 CCTGCAGCCCAGACCCAGGCAGG - Intergenic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1160842918 19:1154485-1154507 GCTGCAGCCCAGGCTGGGACCGG - Intronic
1160866777 19:1259705-1259727 GCTGAAGGCCAGGTCTGGGAAGG - Intronic
1160888887 19:1366486-1366508 GCAGGAGTCCAGGCCCGGGCAGG + Intronic
1160963863 19:1737033-1737055 GCTGAAGCCCAGGCAGGGAGTGG + Intergenic
1161008284 19:1947497-1947519 GCTGATGCCCAGGCTCTGCCTGG + Intronic
1161196215 19:2987974-2987996 GGTGAGACCCAGGCCCGAGCTGG + Exonic
1161309408 19:3585695-3585717 GCGGAAGACGAGGCGCGGGCGGG - Exonic
1161679578 19:5673168-5673190 GCTGAAGCCCAGGTCCCAGAGGG + Intergenic
1161990556 19:7681757-7681779 GCTGGAGCGCAGGGCGGGGCAGG + Intronic
1162474861 19:10893847-10893869 GAGGAAGCCAAGGCCAGGGCTGG + Intronic
1162761972 19:12893781-12893803 GGTGAAGCCCAGGGTCTGGCGGG - Intronic
1163517937 19:17776066-17776088 GCTGGAGCCCGGGCCGGGGCAGG - Exonic
1163580325 19:18134991-18135013 GCTCAAACCCAGGCCCGTGGAGG - Intronic
1163688657 19:18726333-18726355 GAGGAGGCCCAGGCCCGGGAGGG + Intronic
1163703450 19:18798782-18798804 ACAGGAGCCCAGGCCAGGGCCGG + Intergenic
1164469177 19:28514187-28514209 GCAGAAGCCCCAGCCTGGGCTGG - Intergenic
1165481570 19:36067600-36067622 GCTGATGCACAGGCCCTGCCAGG + Intronic
1165952206 19:39480786-39480808 GCTGTAGCTCCGGCCCGGGGCGG + Exonic
1166231495 19:41427668-41427690 GCTGAAGGCTGGGCCTGGGCTGG + Intronic
1166967113 19:46535626-46535648 GTTGAAGACCAGGCCCCGGGGGG - Intronic
1167096633 19:47378005-47378027 ACTGAAGCTCAGGCAGGGGCGGG + Intronic
1167125471 19:47545633-47545655 TCTGAAGCCCCCGCCGGGGCTGG + Exonic
1167278361 19:48552323-48552345 GGTGAGGCCCAGACCTGGGCAGG + Exonic
1167367268 19:49061432-49061454 GCTGATGCCCAGGGCCGTGTGGG - Exonic
1168259555 19:55185829-55185851 GCTGAGGGCCAGGACGGGGCTGG + Intronic
1168402054 19:56090882-56090904 GCTGAAGCACAGGCCCGGCCCGG - Intronic
1202712870 1_KI270714v1_random:27204-27226 GCAGACGCCAGGGCCCGGGCCGG - Intergenic
925847818 2:8049524-8049546 GCTGAAGCCCAGGGCCTGTGAGG + Intergenic
925909672 2:8565602-8565624 GCTGAACCCCAGAACAGGGCAGG - Intergenic
926084053 2:10010040-10010062 GCTGGCGGCCAGGCCAGGGCTGG + Intergenic
926162199 2:10496831-10496853 TCTGAAGCCAAGGTCAGGGCAGG - Intergenic
927087771 2:19688367-19688389 GCAGTAGCCCAGGCCCAGGCAGG + Intergenic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
929938112 2:46309759-46309781 GATGAGGACCAGGCCTGGGCTGG + Intronic
932411634 2:71551165-71551187 GCTGGAGCCCTGGCAAGGGCAGG + Intronic
932435862 2:71702284-71702306 GCTGCACCCCAGCCCCGGGCAGG - Intergenic
932618275 2:73249948-73249970 GCAGAAGACCAGACCCAGGCAGG - Intronic
932764582 2:74461778-74461800 GCTGAAGCCCAGGCCCCCTCAGG - Exonic
933808644 2:86018226-86018248 TCTGAAGGCCTGGCCTGGGCGGG - Intergenic
935983975 2:108654546-108654568 GTGGAAGCCCAGGTCCAGGCAGG + Intronic
936136410 2:109898199-109898221 GTGGAAGCCCAGGTCCAGGCAGG + Intergenic
936208287 2:110473286-110473308 GTGGAAGCCCAGGTCCAGGCAGG - Intergenic
937837296 2:126484479-126484501 GCTGAAGCCTATGGCAGGGCGGG + Intergenic
938466628 2:131529360-131529382 CCTAAAGCCCAGGCCCTGCCTGG + Intronic
942578680 2:177393088-177393110 CCTGCAGCACAGGCCCGGCCTGG - Intronic
946843247 2:223837791-223837813 GCTGCAGCCGAGGCGGGGGCGGG - Intronic
948116176 2:235495268-235495290 GCTGGGGGCGAGGCCCGGGCCGG + Intronic
948250982 2:236528790-236528812 ACTGAAACCCAGGCCCATGCAGG - Intergenic
948742195 2:240055397-240055419 GCAGGAGCGCAGGCCAGGGCAGG + Intergenic
949004243 2:241636681-241636703 TCTGAAGCCTAGGCGCCGGCCGG + Intronic
1170609245 20:17898745-17898767 GCTGAAACCCAGTCCCTGGCTGG - Intergenic
1172116573 20:32576738-32576760 GCTGCAGGCCTGGCCTGGGCGGG - Intronic
1172229038 20:33324683-33324705 GCTGGAGCCCAGGCCCAGGGTGG + Intergenic
1172272603 20:33663182-33663204 GCAGAAGCCCTGGACCAGGCGGG + Intronic
1172641038 20:36440663-36440685 GCTGAGGTCCAGGTCTGGGCTGG - Intronic
1173479797 20:43389976-43389998 ACTGACTCCCTGGCCCGGGCTGG + Intergenic
1173503844 20:43571922-43571944 TCTGATGCCCAGGCACAGGCTGG - Intronic
1173618483 20:44418525-44418547 CCTGGAGCCCTGGCCAGGGCAGG - Intronic
1175248948 20:57597395-57597417 GCTGAAGCCTAGGCCCTCCCGGG - Intergenic
1175265809 20:57702960-57702982 GCTGAAGCCCCTGCCCTGGCTGG + Intronic
1175443778 20:59007206-59007228 GCCGAGGCCGAGGCCGGGGCGGG - Exonic
1175859405 20:62142596-62142618 GCTGCAGCCCGGCCCCGGGAAGG + Intronic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1175901440 20:62361412-62361434 TCTGCAGGCCTGGCCCGGGCTGG - Intronic
1175953783 20:62597624-62597646 GCAGAAGGGCTGGCCCGGGCAGG - Intergenic
1176025709 20:62984462-62984484 GCTCCAGCCCAGGACAGGGCAGG - Intergenic
1176111024 20:63410780-63410802 AATGAAGCCCAGGCCTGAGCTGG - Intronic
1176121908 20:63457838-63457860 GCAGACTCCCAGGCCCTGGCAGG + Intronic
1176426872 21:6553490-6553512 TCTGACTCCCAGGCCAGGGCTGG - Intergenic
1178334538 21:31731807-31731829 GCGGAGTCCGAGGCCCGGGCAGG + Exonic
1178439938 21:32590546-32590568 GCTACAGCCCAGGCCTTGGCAGG - Intronic
1178492056 21:33058682-33058704 GCTGGAACCCAGCCCAGGGCAGG + Intergenic
1179663694 21:42894586-42894608 TCTGTTGCCCAGGCCCAGGCTGG + Intronic
1179702363 21:43161812-43161834 TCTGACTCCCAGGCCAGGGCTGG - Intronic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180226704 21:46397752-46397774 GCTGCAGCACAGGCCCAGCCCGG - Intronic
1180845077 22:18976378-18976400 CCTGCCTCCCAGGCCCGGGCGGG + Intergenic
1180898437 22:19353897-19353919 GGTGGAGACCAGGCCTGGGCAGG + Intronic
1180999893 22:19983163-19983185 GCTGAAACCCAAGCCCTGGTGGG + Intronic
1181050356 22:20235421-20235443 GCAGCAGCCCAGGCCCAGGCAGG + Intergenic
1181056937 22:20264774-20264796 CCTGAGGCCCAGGCCCTGGGTGG + Intronic
1182455567 22:30448143-30448165 CCTGCAGCCCAGGCCTGGGGTGG - Intronic
1182548396 22:31088606-31088628 GGTGAGGCCCAGGCTGGGGCAGG + Exonic
1183298542 22:37046535-37046557 GACAAAGCCCAGGCACGGGCAGG + Intergenic
1183378562 22:37479287-37479309 GCTGATCCCAAGGGCCGGGCCGG - Intronic
1183410246 22:37650688-37650710 GCTGAAGCCAAGGCTGGGGCCGG - Exonic
1183430695 22:37763852-37763874 GCTGCAGCCAAGGCGTGGGCAGG + Intronic
1183487507 22:38097445-38097467 GCACAAGCCCAAGCACGGGCTGG + Intronic
1183526533 22:38326372-38326394 GCTGAAGCTAAGGGCAGGGCTGG + Intronic
1183833998 22:40436943-40436965 GCTGAGGCCCAGCCCCCCGCTGG - Intronic
1184029105 22:41880786-41880808 GCTGCAGGCCAGGTCCAGGCGGG - Exonic
1184330256 22:43822590-43822612 GCTGCTGCCCCTGCCCGGGCTGG - Intergenic
1184531295 22:45057380-45057402 CATGTCGCCCAGGCCCGGGCTGG - Intergenic
1184533452 22:45071161-45071183 CCTGATGCCCAGGCCAGGTCGGG + Intergenic
1184804012 22:46780735-46780757 GCTCCACACCAGGCCCGGGCTGG - Intronic
1184842229 22:47058725-47058747 GCTGAGGCCCAGGCCTTGGTGGG + Intronic
1184967879 22:47994775-47994797 GCTGAAGCCCAGGTCCTGCCCGG - Intergenic
1185242291 22:49753128-49753150 TCTGCCGCCCAGGCCCAGGCTGG + Intergenic
1185246333 22:49775209-49775231 GCCAGAGGCCAGGCCCGGGCAGG + Intronic
1185332746 22:50258979-50259001 GCGGAGGCCCAGGCCAGGGAGGG + Intronic
949893646 3:8752950-8752972 GCTGCAGCCCTGGCCCTGGCTGG + Exonic
950523505 3:13509948-13509970 GCTCAGGCCCAGCCCCAGGCAGG - Intergenic
950526626 3:13528299-13528321 TCTGAACCCCAGGTCTGGGCGGG + Intergenic
953732830 3:45464822-45464844 TCTGAGGACCAGGCCAGGGCTGG + Intronic
954036890 3:47855622-47855644 GCTGCAGGCCAGGCTTGGGCAGG + Intronic
954372532 3:50176340-50176362 GCTGCAGACCTGGCCAGGGCAGG - Intronic
954886711 3:53881690-53881712 GCTGAGGCCAGAGCCCGGGCAGG + Intronic
955392135 3:58529688-58529710 TCTGAAGCCCAGGCCAGGCGAGG + Intronic
955406541 3:58629334-58629356 TCTGAAGTCCAGGCCCTGGCAGG + Intergenic
957939877 3:86991091-86991113 GCCACAGCCCAGGCCCGGGTCGG + Exonic
961013478 3:123450040-123450062 GCTGGAGCCCTGGCCGGGGGCGG - Intergenic
961733835 3:128987901-128987923 GCTGAGGGCCAGGCTGGGGCTGG - Intronic
962200898 3:133400304-133400326 GCTGATGCCGAGGGCCCGGCGGG - Exonic
962318538 3:134373576-134373598 GCAGGAGCCCAGGCCAAGGCTGG - Intronic
962934152 3:140063983-140064005 GCAGAAGCAAAGGCCCTGGCAGG - Intronic
964336322 3:155658435-155658457 GCGGAAGCCCAGACACGGGAAGG + Intronic
967867739 3:194204166-194204188 GCTGGAGCCGACGACCGGGCGGG + Intergenic
968084749 3:195869303-195869325 GCAGAAGCCCAGGCTCCGGGGGG + Intronic
968519888 4:1030457-1030479 GCTGAGGCCCAGGACCCGCCAGG - Intergenic
968556854 4:1249898-1249920 GGTGAAGCCCCGACCCGGGAGGG + Intronic
968615549 4:1575980-1576002 GCTGCAGCCCACAGCCGGGCAGG - Intergenic
968884744 4:3321751-3321773 TCTGAGGCCCAGGCCTGGGCAGG + Intronic
969092604 4:4706504-4706526 GCTGTAGCCAAAGCCTGGGCAGG + Intergenic
969110905 4:4843751-4843773 GCTGAGGCCCGGGCATGGGCAGG - Intergenic
969290363 4:6235190-6235212 GAGGAAGCCGAGGCCTGGGCTGG - Intergenic
969503614 4:7570256-7570278 GGTGGAGCCCAGGCACAGGCAGG + Intronic
969689372 4:8695864-8695886 GCTGCAGCCCTGGGGCGGGCAGG + Intergenic
971977585 4:33710390-33710412 TCTGAAGCCATGGCCCGGTCTGG + Intergenic
972651768 4:41024774-41024796 GCTGCAGCCCAGGCCTGCTCAGG - Intronic
973613738 4:52659494-52659516 GCAGGAGGCCAGGCCTGGGCGGG - Intergenic
979201845 4:117987927-117987949 CCTGAAGCCCCGGCCAGGGGAGG - Intergenic
982647698 4:158044407-158044429 GCAGGAGCCCAGGGCAGGGCGGG - Intergenic
982902489 4:161024710-161024732 TCTGTCGCCCAGGCCCAGGCTGG - Intergenic
985748269 5:1660044-1660066 GCTGAAGCCCTCGCCCCAGCAGG - Intergenic
987329386 5:16842453-16842475 GCTGAAGCCCAGGGCTGGTGAGG - Intronic
989534464 5:42548094-42548116 ACTGAAGGCCAGGCCTAGGCTGG - Intronic
992962687 5:81971927-81971949 GCTGAGACCCAGGCCGGGACTGG - Intergenic
993501552 5:88672803-88672825 GCTGAAGCAAAGCCCCGGACTGG + Intergenic
995433759 5:112112348-112112370 GCTGAAGTCCAGGCATGGCCAGG + Intergenic
996816717 5:127582291-127582313 GCTGAATCCAAGGCGAGGGCAGG + Intergenic
997356553 5:133266453-133266475 GCTGAGGCCGAGGCCCTGCCCGG + Intronic
998157746 5:139796015-139796037 GCTGGCGGCCAGGCCGGGGCGGG + Intronic
998266718 5:140672520-140672542 GCTGCTGCCCAGCCCCGGACCGG - Exonic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
1000509517 5:162164589-162164611 GCTGAATCCAGGGCCTGGGCAGG + Intergenic
1001640808 5:173242855-173242877 GGGGAAGGCCAGGCCCGGACAGG - Intergenic
1002058816 5:176614037-176614059 GCTGGCGCCCAGGCCGGGGGTGG + Intergenic
1002515649 5:179756393-179756415 TCTGTCGCCCAGGCCCAGGCTGG - Intronic
1002523622 5:179804359-179804381 GCTGAAGTCCAGGCCTGGGGAGG + Intronic
1002785042 6:393606-393628 GCTGAAGGCCCGGCCGGGCCCGG + Intronic
1002927867 6:1615098-1615120 GCCGCAGCGCCGGCCCGGGCAGG - Intergenic
1003116404 6:3286633-3286655 GGTGCAGCCCGGGCCGGGGCAGG + Intronic
1006116192 6:31777277-31777299 GCAGCAGCCCACGCCAGGGCGGG + Exonic
1006220340 6:32484377-32484399 CCTGACAGCCAGGCCCGGGCTGG + Intergenic
1006735568 6:36270386-36270408 GCGGCAGCCCAGGCTCGGGCAGG + Intronic
1006807846 6:36800089-36800111 GGTGAACCTCAGGGCCGGGCTGG + Intronic
1007722176 6:43891554-43891576 GCGGGCGCCCAGGGCCGGGCGGG + Intergenic
1007746321 6:44045725-44045747 GCAGAAGCCTAGGACTGGGCAGG + Intergenic
1011504970 6:88031435-88031457 GCTGCAGCCCAGGCCTGCTCAGG - Intergenic
1012916833 6:105179842-105179864 GCTGAAGCTCCGGGCAGGGCTGG - Exonic
1017676474 6:156819768-156819790 CCTGAACTCCAGGCCCGGGCAGG - Intronic
1017759468 6:157556812-157556834 GCTGAAGGACAGGCCCGGGCGGG + Intronic
1018823838 6:167394550-167394572 GCTACAGCCCAGGCCTTGGCAGG - Intergenic
1019172017 6:170138053-170138075 ACTGAGGGCCAGGGCCGGGCCGG - Intergenic
1019182009 6:170193399-170193421 TCTGAAGCCAAGGCCCTGGACGG + Intergenic
1019261568 7:84685-84707 ACTGGAGCCAAGGCCTGGGCAGG + Intergenic
1019343318 7:518514-518536 GCGGAAGCCCCTGGCCGGGCAGG - Intronic
1019509606 7:1411213-1411235 GCTGAGGGCCAGGCCAGGGCTGG - Intergenic
1019620478 7:1989467-1989489 GCAGAAAGCCAGGCACGGGCTGG + Intronic
1019664921 7:2247093-2247115 ACTGAAGCCCAGGGCCGTGCTGG - Intronic
1019693720 7:2432780-2432802 GCCGCTGCCCACGCCCGGGCCGG + Exonic
1022421495 7:30227694-30227716 CCTGAATCCCAGGCCCTTGCTGG + Intergenic
1022501254 7:30883559-30883581 GCTGAGGCTCAGGCCAGGGGAGG + Intronic
1023453999 7:40318725-40318747 GCTGAAGGCCAGGCCAGGCATGG - Intronic
1025089722 7:56051996-56052018 GCTGAACCGGAGGGCCGGGCGGG + Intronic
1025216509 7:57060859-57060881 GCTGCAGCCCACGCCCTGCCAGG + Intergenic
1025654871 7:63509871-63509893 GCTGCAGCCCACGCCCTGCCAGG - Intergenic
1026979548 7:74518336-74518358 GCCCCAGCCCAGCCCCGGGCCGG - Intronic
1029223133 7:99005916-99005938 GCTGGCGCCCAGGCTCGGCCGGG - Intronic
1029243004 7:99177831-99177853 GCAACAGCCCAGGCCCCGGCAGG + Intronic
1029443613 7:100601201-100601223 GCAGGAGCCCAGGCAGGGGCAGG + Intergenic
1034256249 7:149726071-149726093 GATGAACCCCAGCCTCGGGCTGG - Intronic
1034270838 7:149802838-149802860 GCTGCTGCCCAGGCCGGGGGAGG + Intergenic
1034327274 7:150248083-150248105 GCTGAAACCCTGGCAGGGGCAGG - Intronic
1034765935 7:153721374-153721396 GCTGAAACCCTGGCAGGGGCAGG + Intergenic
1034957711 7:155344894-155344916 GCTGAGGCCCCGGCCCGAGGAGG + Intergenic
1035265199 7:157686156-157686178 GCTGGATCCCAGGGCCCGGCTGG + Intronic
1037705302 8:21312195-21312217 GCTGAGATCCAGTCCCGGGCTGG + Intergenic
1037835694 8:22213651-22213673 GCTGAAGCCCCTGCCTGGACAGG - Intergenic
1038146827 8:24904985-24905007 GCTGAAACCAAGGAGCGGGCAGG - Intergenic
1038427677 8:27474806-27474828 GCTGATGCCCAGGCTGGGGTGGG - Intronic
1038552353 8:28481060-28481082 TCTGATGCCCAGGCCCGGCTCGG - Intronic
1039688597 8:39837414-39837436 TCTGTCGCCCAGGCCCAGGCTGG + Intronic
1042611746 8:70608014-70608036 TCTGGAGCCCGGGCCCGGGCTGG + Intronic
1044680359 8:94771695-94771717 GCATATGCCCAGGCCTGGGCAGG + Intronic
1048244185 8:132775556-132775578 GCAGAGGCAGAGGCCCGGGCTGG + Exonic
1049095201 8:140544573-140544595 GCTCAGGCCCAGGCCCAGGAGGG + Intronic
1049291470 8:141805187-141805209 GTGGAAGCCCAGGCACAGGCTGG - Intergenic
1049400893 8:142426743-142426765 GCTGAAGCCCAGGGGAGTGCTGG + Intergenic
1049405345 8:142449810-142449832 GCTGGCGCGCGGGCCCGGGCCGG - Exonic
1049583084 8:143421519-143421541 GCTGGAGCCGAGGCCGGGCCAGG + Intronic
1049599747 8:143501917-143501939 GCTGAAGCCCTGACCCCAGCGGG + Intronic
1049657453 8:143805084-143805106 GCTGGGGCCCAGGGCCGGGGAGG - Intronic
1049689924 8:143953890-143953912 GCTGAAGCCCCGCCCCTGGCCGG - Intronic
1049784511 8:144444125-144444147 GCCGGGGCCCGGGCCCGGGCCGG - Intronic
1049788402 8:144462236-144462258 GCTGCAGCCCCGGGCTGGGCCGG + Intronic
1049790590 8:144470710-144470732 GCTGGAGCCCAGGCACAGACAGG - Intronic
1049879618 8:145052886-145052908 GCTGAGGCCCAGGCAAGGGCGGG + Exonic
1053196349 9:36122019-36122041 GCTGATGCCCAAGCCGGGGAAGG + Intronic
1056507402 9:87270286-87270308 ACAGAAGCCCAGGCCGGCGCTGG + Intergenic
1057802445 9:98198523-98198545 GCTGCAGCGCAAGCCAGGGCTGG - Intergenic
1058090168 9:100797130-100797152 ACTGAAGCTCAGGGCTGGGCTGG + Intergenic
1059470856 9:114504337-114504359 GCTGAAGCCCAAGCCCTCGTGGG + Exonic
1060144817 9:121242883-121242905 GCAGAAGCCCAGGAGCAGGCAGG - Intronic
1060283073 9:122227002-122227024 TCTGACGCCGAGGCCCTGGCAGG - Exonic
1061328741 9:129879469-129879491 GCTGACCCCCAGGCCTGGGGCGG + Intronic
1061489246 9:130936175-130936197 GGTGAAGCCCAGGCCCAGAGAGG + Intronic
1061680306 9:132239759-132239781 GCTGAGGCCCAGGAACGGGAAGG - Intronic
1061868178 9:133506174-133506196 GCAGAAGCCCTGGCCAGGCCCGG + Intergenic
1062104991 9:134750480-134750502 GCTGCAGCCCAGCCCTGGCCTGG + Intronic
1062140501 9:134955249-134955271 CCTCAAGCCCAGGCCCTGGCAGG - Intergenic
1062325923 9:136012461-136012483 GCAGGAGCCCAGGCCAAGGCCGG + Intronic
1062383028 9:136296715-136296737 TCTGAAACCCATGCCCAGGCTGG + Intronic
1062423778 9:136496872-136496894 GCTGGAGCCCAGGACGGTGCTGG + Exonic
1062454197 9:136628014-136628036 GCCGCAGCCCTGGCCCGAGCTGG - Intergenic
1062526746 9:136980989-136981011 GCTGCAGTCCAGGGCCGGGCGGG + Intronic
1185432971 X:19967-19989 GCAGCGGCCCAGCCCCGGGCGGG + Intergenic
1185504050 X:619205-619227 GCTCAGGCGCCGGCCCGGGCCGG - Intergenic
1186324266 X:8461603-8461625 TCTGTCGCCCAGGCCCAGGCTGG - Intergenic
1186466095 X:9785923-9785945 GTTGGAGGCCAGGACCGGGCAGG - Intronic
1186551476 X:10510540-10510562 GCTGAAACCCAGGCCGGGCGTGG + Intronic
1187232338 X:17434941-17434963 GCTGGAGCCCTGGGCCAGGCTGG + Intronic
1189659336 X:43279758-43279780 GCTGCAGCCTCGGGCCGGGCGGG + Intergenic
1189717726 X:43882544-43882566 TCTGCAGCCCAGGCCCGGGGAGG + Intergenic
1192166316 X:68829552-68829574 GCCGAAGCCCATGCCCGGGTTGG + Exonic
1192362863 X:70450160-70450182 GCTGAAACCCAGGCCTGAGCGGG - Exonic
1194949758 X:100111181-100111203 TCTGTTGCCCAGGCCCAGGCTGG + Intergenic
1195675882 X:107506974-107506996 GCAGCAGCCCAGCCCCGGCCCGG + Intergenic
1196791537 X:119468912-119468934 CTTGACGCCCAGGCCCGGGGAGG - Intronic
1197199029 X:123732898-123732920 GCTGACGCCCTGGCCCGGCCCGG + Intronic
1198015253 X:132603782-132603804 GCTGAACCCCAGGGGCTGGCAGG - Intergenic
1198537748 X:137602638-137602660 TCTGTCGCCCAGGCCCAGGCTGG + Intergenic
1199982077 X:152926648-152926670 GCTGAAGTCCAGGACCACGCTGG - Intronic
1200058836 X:153475052-153475074 GCTGGAGCTCAGGCCCGGCCGGG - Intronic
1200070645 X:153527372-153527394 GCTGCTGGGCAGGCCCGGGCTGG + Intronic
1200104641 X:153705554-153705576 GCTGTAGCCCAGTGCGGGGCAGG - Intronic
1200115385 X:153767672-153767694 GATGAGGCCCTGGCCCTGGCAGG - Exonic
1200124031 X:153804844-153804866 GCTGTTGCTCAGGCCTGGGCCGG + Exonic
1201059711 Y:10035410-10035432 GCTGCAGGCCAGGCAAGGGCCGG - Intergenic