ID: 1104929608

View in Genome Browser
Species Human (GRCh38)
Location 12:132331263-132331285
Sequence CTGTGTATGCACATGTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 1, 2: 18, 3: 137, 4: 857}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104929607_1104929608 -8 Left 1104929607 12:132331248-132331270 CCTGTGTGTGTGTGTCTGTGTAT 0: 1
1: 69
2: 1876
3: 3565
4: 6138
Right 1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG 0: 1
1: 1
2: 18
3: 137
4: 857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104929608 Original CRISPR CTGTGTATGCACATGTGTGT AGG Intergenic
900164392 1:1238955-1238977 ACGTGTCTGCACATCTGTGTGGG - Intergenic
900215480 1:1479383-1479405 GTGTGTGTGCCCATGTGTGCAGG - Intronic
900284532 1:1892693-1892715 GTGTGTATACATATGCGTGTGGG - Intergenic
900299796 1:1970975-1970997 GTGTGTGTGCACGTGTGTGCAGG - Intronic
900299798 1:1971034-1971056 ATGTGTGTGCACGTGTGTGCAGG - Intronic
900299800 1:1971096-1971118 ATGTGTGTGCACACGTGTGCAGG - Intronic
900299808 1:1971330-1971352 ATGTGTGTGCACGTGTGTGCAGG - Intronic
900464615 1:2819373-2819395 CAGGGTGTGCAGATGTGTGTGGG - Intergenic
900489172 1:2937908-2937930 TTGTGTGTGCCCATGTGTGGGGG - Intergenic
900489178 1:2938007-2938029 CTGTGTGTGCACATGTGTAGGGG - Intergenic
900489199 1:2938383-2938405 CTGTGTGTGCATGTGTGTGGGGG - Intergenic
900563665 1:3321408-3321430 GAGTGTATGCATTTGTGTGTGGG + Intronic
900566767 1:3336388-3336410 AAATGCATGCACATGTGTGTTGG + Intronic
900566768 1:3336428-3336450 GTTTGCATGCACATGTGTGTTGG + Intronic
900566772 1:3336548-3336570 GCATGCATGCACATGTGTGTTGG + Intronic
900566774 1:3336622-3336644 GCATGCATGCACATGTGTGTTGG + Intronic
900566775 1:3336704-3336726 ACATGCATGCACATGTGTGTTGG + Intronic
900566776 1:3336746-3336768 GCCTGCATGCACATGTGTGTTGG + Intronic
900566778 1:3336788-3336810 GCATGCATGCACATGTGTGTTGG + Intronic
900566784 1:3336999-3337021 GCATGCATGCACATGTGTGTTGG + Intronic
900593540 1:3470232-3470254 GTGTGTATGCATGGGTGTGTGGG + Intronic
900705539 1:4077883-4077905 CTGTGTCTGCAGATGACTGTTGG - Intergenic
900705561 1:4077999-4078021 CTGTGTCTGCAGATGACTGTTGG - Intergenic
900865154 1:5263456-5263478 GTGGGTATGCATATATGTGTGGG + Intergenic
900908111 1:5575154-5575176 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
900969630 1:5983712-5983734 ATGTGTATGCACTTGTGTTAGGG - Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
901233643 1:7655652-7655674 GTGTGTGTGCATAGGTGTGTGGG - Intronic
901465231 1:9417069-9417091 ATGAGCATGCATATGTGTGTGGG - Intergenic
901474163 1:9477732-9477754 ATGTGTGTGTATATGTGTGTGGG - Intergenic
901574197 1:10186853-10186875 GTGTGTGTGCATGTGTGTGTAGG - Intergenic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901856395 1:12046936-12046958 TTGTGTGTGCAAATGTGTGACGG - Intergenic
902107517 1:14050098-14050120 ATGTATGTGCACATGTGTGTGGG + Intergenic
902538344 1:17134849-17134871 GTGTGTGTGCACAGGTGTGTGGG - Intergenic
902538368 1:17135051-17135073 GTGTGTATGTGCATGTGGGTGGG - Intergenic
902695046 1:18134606-18134628 CTGTGGATGCACATGGGCATTGG + Intronic
902734969 1:18394417-18394439 CTGAGGGTGCACATATGTGTTGG - Intergenic
903185042 1:21624128-21624150 CTGTGTATGTACGTGTGTGCAGG + Intronic
903325151 1:22564957-22564979 CTGTGTGTGTGCTTGTGTGTAGG - Intronic
903340311 1:22650228-22650250 GTGTGCATGCATATGCGTGTGGG - Intergenic
903345040 1:22678501-22678523 ATGTGTGTGCATGTGTGTGTGGG - Intergenic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
903668080 1:25020042-25020064 ATGTGTGTGCATGTGTGTGTGGG - Intergenic
903668088 1:25020214-25020236 ATGTGTGTGCACGTGTGTGTAGG - Intergenic
904029738 1:27526750-27526772 CTGTGTATGGAGGTGTATGTAGG + Intergenic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
904402368 1:30265312-30265334 CTGTGAGGGCACATGTGTGGCGG - Intergenic
904418615 1:30377505-30377527 GGGTGTGTGCACATGTGTGGAGG - Intergenic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905027768 1:34862942-34862964 CCATGGAAGCACATGTGTGTTGG - Intergenic
905238885 1:36570040-36570062 CTGTGTATGCAGGTGGGTCTAGG - Intergenic
905394181 1:37656771-37656793 CTCTGTGTGTCCATGTGTGTTGG + Intergenic
905872642 1:41414003-41414025 GTGAGTATGCACAGGTGTGCGGG - Intergenic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
906694643 1:47815750-47815772 ATGTGTGTGCACACATGTGTGGG + Intronic
907640834 1:56188692-56188714 ATGTGTAAGCATGTGTGTGTGGG - Intergenic
908519616 1:64928475-64928497 TTGTGTGTGCATATTTGTGTAGG - Intronic
909106474 1:71415902-71415924 GTGTGTATGTGGATGTGTGTGGG + Intronic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
910171043 1:84377504-84377526 ATGTGTGTGCACATGTTTATGGG - Intronic
910342614 1:86204922-86204944 GTGTGTAAGCATATGTGTGTGGG - Intergenic
910947213 1:92607121-92607143 ATGTGTATGTACCAGTGTGTTGG - Intronic
911496190 1:98634318-98634340 GTTTGTATGTACGTGTGTGTGGG - Intergenic
911875336 1:103155192-103155214 GTGTGTATATATATGTGTGTGGG + Intergenic
912119340 1:106451025-106451047 GTGTGTATGTGCATATGTGTGGG - Intergenic
912201776 1:107465939-107465961 GTGTGTGTGCATATGTGTGTGGG + Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913368771 1:118072818-118072840 CTGTACATGCACATGTGTGTTGG + Intronic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913693291 1:121300129-121300151 ATTTGTATGCACATGTATCTAGG - Intronic
914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG + Intronic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
915061945 1:153193425-153193447 GTGTGCATGCACATGTTTGAGGG - Intergenic
915097675 1:153475012-153475034 GTGCATATGCATATGTGTGTAGG - Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915882788 1:159689716-159689738 GTGTGCATGCACGTGTGTGTGGG - Intergenic
917486638 1:175460898-175460920 ATGAGCATGTACATGTGTGTGGG - Intronic
917659941 1:177168010-177168032 GTCTGTGTGCACATGTGTGGTGG - Intergenic
917757168 1:178113474-178113496 TTGTGTATGTGTATGTGTGTGGG + Intronic
919085420 1:192915406-192915428 TTGTGGAAGCACATGTCTGTTGG + Intergenic
920108728 1:203572456-203572478 GTGTGCATGCACAGCTGTGTGGG - Intergenic
920169973 1:204065777-204065799 GTGTGTATTCGCATGCGTGTGGG + Intergenic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920480613 1:206318498-206318520 ATTTGTATGCACATGTATCTAGG - Intronic
921300245 1:213745040-213745062 CTTTGTGTTCACATCTGTGTAGG - Intergenic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921715602 1:218414214-218414236 GTGTGTGTGCACATGTGTTTAGG - Intronic
921874701 1:220181391-220181413 CTGTGTATGCATGCATGTGTAGG + Intronic
922093815 1:222423817-222423839 CTCTGTGTGCACATGTGTTGAGG - Intergenic
922475912 1:225906929-225906951 GTGTGTGTGCACATGCGTGTGGG + Intronic
922907278 1:229183784-229183806 ATGTGTGTGCAGATGTGAGTGGG - Intergenic
922996991 1:229972016-229972038 GAGTGTATGTACATGTGAGTGGG - Intergenic
923013928 1:230111336-230111358 ATGTGTATGCAAATGTGCATGGG - Intronic
923377947 1:233384709-233384731 GTGTGTTTGCATGTGTGTGTTGG + Exonic
924033034 1:239906636-239906658 TTTTATATGCAAATGTGTGTGGG + Intronic
924640816 1:245831842-245831864 GTGTGCATGCACGTGTGTGAGGG + Intronic
924857048 1:247884116-247884138 CTGTGTATGTCTTTGTGTGTTGG - Intergenic
1063054563 10:2490334-2490356 CTGTGTGTGCGCATGTGTGGTGG - Intergenic
1063061323 10:2557099-2557121 GTGTGTGTGCACACGTGTGGGGG + Intergenic
1063331179 10:5161049-5161071 GTGTGTATATATATGTGTGTGGG + Intergenic
1063368067 10:5503293-5503315 TTGTGTGTGCATGTGTGTGTGGG + Intergenic
1063374299 10:5544835-5544857 GTGTGTGTGCACATGTACGTGGG - Intergenic
1063482380 10:6386910-6386932 CTGTGTATGTGCCTGTATGTGGG - Intergenic
1064019155 10:11795446-11795468 GTGTGGGTGCACGTGTGTGTGGG - Intergenic
1064283426 10:13971063-13971085 ATGTGTGTGCACCTGTGTGTTGG - Intronic
1065153038 10:22841734-22841756 TTATGTGTGCATATGTGTGTGGG - Intergenic
1065195243 10:23257916-23257938 GTGTGTATACATATATGTGTGGG - Intergenic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1065706171 10:28473375-28473397 CTTTTTATGTATATGTGTGTTGG - Intergenic
1065877344 10:30008943-30008965 CTGTATATGCAGAAGAGTGTAGG + Intergenic
1065997592 10:31073699-31073721 GTGTGCGTGCGCATGTGTGTAGG + Intergenic
1066108980 10:32179784-32179806 GTGTGTGTGCAGATGTGGGTGGG + Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1066316159 10:34248656-34248678 CTGTGTGTGCAGGTGTGTGCTGG - Intronic
1066471686 10:35703973-35703995 ATGTGTGTGCGTATGTGTGTTGG - Intergenic
1066650642 10:37651692-37651714 GTGTGTGTGCACCTGTGTGCAGG - Intergenic
1067087831 10:43252209-43252231 CTGTGTATGCACACCCATGTGGG - Intronic
1067263377 10:44714375-44714397 AGGTATATACACATGTGTGTAGG + Intergenic
1067438157 10:46293232-46293254 GTGTGTATGCATGTGTGTGGGGG + Intronic
1068284135 10:54912979-54913001 TTGTTTATGCAGATGAGTGTAGG - Intronic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068568328 10:58600116-58600138 CTGCTTCTGCCCATGTGTGTTGG + Intronic
1069109052 10:64421935-64421957 CTGAGAATGCACATTTGTTTGGG - Intergenic
1070802870 10:79253859-79253881 GTGTGCATGTACCTGTGTGTGGG - Intronic
1070809074 10:79288511-79288533 GTGTGTGTGCGTATGTGTGTTGG - Intronic
1070823568 10:79377312-79377334 ATGTGTGTGCACATGTGTGTGGG + Intergenic
1071513825 10:86283915-86283937 GTGTATATGCAGATGTGTGAGGG - Intronic
1071701050 10:87936681-87936703 GTATGTATGCATATGTGTGTGGG - Intronic
1072445096 10:95492573-95492595 CTGAGTATGCACCTGTGTTATGG + Intronic
1072696105 10:97604074-97604096 CTGTGAAGGCAAATGTGAGTAGG - Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1073061462 10:100736145-100736167 CTCTGTGTGTACCTGTGTGTAGG + Intronic
1073488415 10:103836641-103836663 GTGTGTGTGCACTCGTGTGTTGG - Intronic
1073625586 10:105092586-105092608 TTGTGAATGCACAAGTGTGAGGG - Intronic
1074390250 10:113051181-113051203 GTGTGTATGCACATGTATGAAGG - Intronic
1074833756 10:117269194-117269216 GTGTGTATGTGTATGTGTGTAGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074869083 10:117562966-117562988 ATGTGTATGCATATGTGTACAGG + Intergenic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075181213 10:120213752-120213774 CTGTGGATGCACATAGGAGTGGG - Intergenic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1075913143 10:126143521-126143543 GTGTATATGTACATGTGTATGGG + Intronic
1076253207 10:128999250-128999272 GTGTGTGTGCGCATGTGTTTAGG - Intergenic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076745970 10:132514681-132514703 GTGTGTATGCACATATGTATTGG + Intergenic
1076778777 10:132712421-132712443 ATGTGTGTGCACGCGTGTGTGGG + Intronic
1076903046 10:133349218-133349240 CTGTGTGTGCATGTATGTGTTGG - Intronic
1077039832 11:515137-515159 CTGTGGGTGCACATGTGGGGAGG + Intergenic
1077041955 11:528756-528778 ATGTGTGTGCACGTGTATGTGGG - Intergenic
1077167057 11:1147745-1147767 ATGTGTATGCAGGTGTGTGTGGG + Intergenic
1077281038 11:1746027-1746049 ATGTGTGTGCACAAGTGTGTGGG - Intronic
1077425057 11:2471570-2471592 GTGTGTGTGCACGTGTGTATGGG + Intronic
1077425063 11:2471636-2471658 ATGTGTGTACACATGTGTATGGG + Intronic
1077425067 11:2471666-2471688 ATGGGTGTGCACATGTGTATGGG + Intronic
1077425084 11:2471872-2471894 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425091 11:2471994-2472016 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425094 11:2472046-2472068 GTATGTGTGCACATGTGTGTAGG + Intronic
1077425102 11:2472193-2472215 CTATGTGTGCACATGTGTGTAGG + Intronic
1077425107 11:2472263-2472285 GTGTATGTGCACATGTGTATAGG + Intronic
1077431142 11:2516600-2516622 GGGTGTCTGCACCTGTGTGTTGG - Intronic
1077436675 11:2542824-2542846 CTGTTTATCCACTTGTGTGCTGG + Intronic
1077784620 11:5369259-5369281 ATATGTATGCCCATGTGTGTGGG + Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078930262 11:15907008-15907030 GTGTGCATACACGTGTGTGTAGG - Intergenic
1078986940 11:16606438-16606460 CTGTGAAAGCAAATGCGTGTCGG - Intronic
1079145773 11:17850392-17850414 CTGTATGTGTACGTGTGTGTTGG - Intronic
1079286007 11:19133370-19133392 GTGTGTATATATATGTGTGTGGG - Intronic
1079596561 11:22256837-22256859 ATCTGTATGCATATTTGTGTGGG - Intronic
1079908428 11:26278859-26278881 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
1079917475 11:26387710-26387732 CTTTTTATGCACATGTATTTTGG + Intronic
1080625044 11:34021445-34021467 ATGTGTGTGCACACATGTGTAGG - Intergenic
1080884199 11:36350333-36350355 GTGTGTATGCATGTGTGTGCCGG + Intronic
1080960765 11:37157159-37157181 CAGTGAATGAACCTGTGTGTGGG + Intergenic
1081050570 11:38335468-38335490 TTGTGTTTGCACTTCTGTGTAGG + Intergenic
1081102153 11:39016769-39016791 ATGTGTGTGCACCTGTGTATGGG - Intergenic
1081157229 11:39708434-39708456 CTGTGTGTGCCTCTGTGTGTTGG - Intergenic
1081410319 11:42750026-42750048 ATGTGAATGGACATGTGGGTGGG - Intergenic
1081621833 11:44623391-44623413 CTGTGTGTGCACGTGTGTCCTGG - Intergenic
1081677351 11:44978652-44978674 GTGTGCATGCATGTGTGTGTAGG + Intergenic
1081874938 11:46402004-46402026 CAGTGTATGCCCATCTGTGCAGG - Intronic
1081994848 11:47357196-47357218 GTGTGTGTGCAGATATGTGTGGG - Intronic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1083327172 11:61878683-61878705 CTGGGTCTGCCCAAGTGTGTGGG - Intronic
1083686567 11:64379693-64379715 GTGTGTAAGCACAAGTGTGTGGG + Intergenic
1084009940 11:66341963-66341985 CTGTGTATGTGCTTGTGTGTAGG + Intronic
1084303940 11:68269613-68269635 GTGTGAGTGCACATGTGTGGTGG - Intronic
1084609167 11:70190889-70190911 CTGTGTGTGCGCATATGTGCTGG + Intergenic
1084676199 11:70636794-70636816 GTGTGTGTGAACATGTGTGTGGG + Intronic
1084676232 11:70637103-70637125 GTGTGTATGTGCACGTGTGTGGG + Intronic
1084765846 11:71307902-71307924 CTGTCTCTGCACATGTCTGCAGG + Intergenic
1085029801 11:73264279-73264301 CTTTGTATTGATATGTGTGTGGG - Intergenic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1085782962 11:79425953-79425975 ATGTTTGTGCACAGGTGTGTGGG - Intronic
1086412912 11:86559847-86559869 CTGAGTATGCACTTATGTGTGGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087548468 11:99614953-99614975 GTGTGTGTGCATGTGTGTGTAGG + Intronic
1088834695 11:113567878-113567900 CTGTGGCTCCACATGTGTGCAGG - Intergenic
1088913423 11:114209306-114209328 TTGTGTATGCATGTGTATGTAGG + Intronic
1089632251 11:119791194-119791216 GTGTGTGTGCACATGTGGGCAGG + Intergenic
1089681284 11:120120332-120120354 GTGTGTGTGTACATGTGTGGGGG - Intronic
1090401333 11:126450139-126450161 ATGTGTATACACATGTATGTGGG + Intronic
1090585557 11:128208166-128208188 GTGTGTATGTATGTGTGTGTTGG - Intergenic
1090826402 11:130389837-130389859 ATGTGCATGCACATGTGTATAGG + Intergenic
1090833527 11:130437208-130437230 GTGTGTGTGCACATGTGTGTAGG - Intergenic
1090881802 11:130839573-130839595 CTGGGGATGCTGATGTGTGTTGG + Intergenic
1090975987 11:131680471-131680493 GTGTGTGTGCACGTCTGTGTAGG + Intronic
1091040840 11:132279737-132279759 GTGGGTATGGGCATGTGTGTGGG - Intronic
1091301877 11:134513188-134513210 GTGTGTGTGCAGGTGTGTGTGGG - Intergenic
1091345103 11:134847184-134847206 GTGTGTGTGCACGTGTGTGTAGG + Intergenic
1091592540 12:1853507-1853529 ATGTGTGTGCCCATGAGTGTTGG - Intronic
1091683858 12:2547543-2547565 CTGTGTGTGTAAATGCGTGTGGG + Intronic
1091713777 12:2761537-2761559 GTGTGTGTGCATGTGTGTGTTGG - Intergenic
1091776882 12:3190454-3190476 CAGTGTGTGCATATGTGTATGGG + Intronic
1091900355 12:4139688-4139710 GTGTGTGTGCATATGTGTGATGG - Intergenic
1092268752 12:7004622-7004644 GTGTGTATACACATATGTATGGG - Intronic
1092632891 12:10403329-10403351 GTGTGTATACACAGGTGTGTTGG - Intronic
1092844766 12:12574006-12574028 GTGTGATGGCACATGTGTGTAGG + Intergenic
1092907140 12:13111661-13111683 CTGAGCATGCACCTGTGTTTCGG - Intronic
1092937074 12:13374090-13374112 GTGTGTGTGCATGTGTGTGTTGG + Intronic
1093308477 12:17547912-17547934 CAGTGTGTGCACATGGTTGTGGG + Intergenic
1093506500 12:19872679-19872701 CTGTGGCTGCACATGAGTGATGG + Intergenic
1093545653 12:20343290-20343312 CTGTGTATGTGCATATGTGTTGG - Intergenic
1094272739 12:28635588-28635610 GTGTGAATGCACGTGGGTGTGGG + Intergenic
1094473423 12:30823584-30823606 GTGTGTGTGCGCATGTGTGAGGG + Intergenic
1094734054 12:33213102-33213124 CTGTGTATGCACAGATCTGAAGG + Intergenic
1095050370 12:37548696-37548718 CTGTGTGTGCGTGTGTGTGTTGG + Intergenic
1096558094 12:52416270-52416292 ATGTGTATGCATGTGTGTGTGGG + Intergenic
1096747978 12:53740898-53740920 CTGTGTATCTGCATGTGTGCAGG + Intergenic
1096849936 12:54428915-54428937 CTGTGTATATATGTGTGTGTTGG - Intergenic
1097191827 12:57222988-57223010 GTGTGTGTACACATGGGTGTGGG + Intronic
1097343687 12:58467676-58467698 TTGTTTATGCAAATGAGTGTAGG + Intergenic
1097768837 12:63556948-63556970 TTGAGTATGCATATGTTTGTTGG - Intergenic
1097785191 12:63751578-63751600 TTGAGTATGCATATGTTTGTTGG - Intergenic
1098219830 12:68257469-68257491 GTGTGTGTGCACACGTGCGTGGG + Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1098774827 12:74599850-74599872 TTGTTTATGCAAATGAGTGTAGG - Intergenic
1099178384 12:79449950-79449972 GTGTGTGTGCACATTTGTTTGGG + Exonic
1099880333 12:88459847-88459869 GTGTGTGTGCACGTGTGTGTTGG + Intergenic
1100158025 12:91824515-91824537 CTGAGTCTGCACAGATGTGTAGG + Intergenic
1101174614 12:102136679-102136701 ATGTGTGTGCACATGTGTAGTGG + Intronic
1101224795 12:102677254-102677276 CTGAGTAGGCTCATGTGTCTGGG - Intergenic
1101550910 12:105760707-105760729 GTGTGGACGCATATGTGTGTAGG + Intergenic
1101584102 12:106069254-106069276 CTGTGAATACATATGTGTGTTGG - Intronic
1101802814 12:108036993-108037015 CTGTGGATGGAGAGGTGTGTGGG + Intergenic
1102029672 12:109732729-109732751 GTGTGTGTGTACACGTGTGTGGG - Intronic
1102097731 12:110253656-110253678 ATCTTTATGCATATGTGTGTAGG + Intergenic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103379699 12:120484331-120484353 GTGTGTATACAGATGTGGGTGGG + Intronic
1103639142 12:122334915-122334937 GTGTGTATGGACATGTGGGAAGG + Intronic
1103907213 12:124333858-124333880 GTGTGTGTGCGCATGTGTGCGGG + Intronic
1103907223 12:124333994-124334016 GTGTGTGTGCGCATGTGTGTGGG + Intronic
1104055244 12:125225083-125225105 ATGTGTGTGCACATGTGTGCAGG - Intronic
1104060619 12:125264821-125264843 GTGTCTATGCACATGCGTTTGGG - Intronic
1104593909 12:130106530-130106552 ATGTGTATGTCCTTGTGTGTAGG + Intergenic
1104607017 12:130197487-130197509 CTATGTATGTATGTGTGTGTGGG + Intergenic
1104929608 12:132331263-132331285 CTGTGTATGCACATGTGTGTAGG + Intergenic
1104944965 12:132411535-132411557 CTGTGTGTGCCTATGTGTGTGGG - Intergenic
1105234130 13:18530825-18530847 CTCTTTATGCACATCAGTGTGGG - Intergenic
1105601300 13:21891011-21891033 ATGTATATGCATGTGTGTGTGGG - Intergenic
1105962215 13:25352533-25352555 GTGTATGTGCACATGTGTGAGGG + Intergenic
1106486072 13:30173883-30173905 GTGTGTGTGCACATGTGTGTGGG - Intergenic
1106513242 13:30429701-30429723 TTGTGTTTGCACATGTTTTTTGG + Intergenic
1107022006 13:35761422-35761444 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022086 13:35762476-35762498 TTGTGTATGTATGTGTGTGTAGG - Intergenic
1107022096 13:35762633-35762655 GTGTGTATGTATGTGTGTGTAGG - Intergenic
1107282122 13:38748903-38748925 CTGTGCATGCATGTGTGTGCAGG + Intronic
1107357649 13:39584862-39584884 CTGTGTGTGCACAGTTGTCTTGG - Intronic
1107733634 13:43373573-43373595 GTGTGTATGTGTATGTGTGTGGG - Intronic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108034322 13:46272835-46272857 CTGTGTATGTATGTGTCTGTGGG - Intronic
1108195129 13:47985995-47986017 CTTTTTAATCACATGTGTGTTGG + Intronic
1108413826 13:50177454-50177476 TTCTGTATGTATATGTGTGTGGG + Intronic
1108831173 13:54480418-54480440 TTGGGCATGCATATGTGTGTGGG + Intergenic
1109036294 13:57265490-57265512 GTGTGTATGCACGTTTGTATGGG + Intergenic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109560471 13:64042643-64042665 GTGCGCACGCACATGTGTGTAGG + Intergenic
1110370360 13:74733094-74733116 GTGTGTATGTGCATGTGTTTAGG - Intergenic
1110394057 13:75009565-75009587 GTGTATATGCATGTGTGTGTGGG - Intergenic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1111065684 13:83088781-83088803 TTGTTTATGCAAATGAGTGTAGG - Intergenic
1111087040 13:83389425-83389447 GTGTGTGTGCACGTGTGTGAGGG + Intergenic
1111108620 13:83677275-83677297 ATGTGTATGTATATGTGTGATGG + Intergenic
1112261966 13:97885269-97885291 GTGTGTGTGCAGGTGTGTGTGGG - Intergenic
1112261971 13:97885296-97885318 GTGTGTGTGCAGGTGTGTGTGGG - Intergenic
1112358681 13:98696678-98696700 CTGTGTATGAGCACGTGTGGGGG + Intronic
1112439379 13:99415002-99415024 GTGTGTGTGCACGTGTGAGTGGG - Intergenic
1112565703 13:100549827-100549849 GTGTATGTGCTCATGTGTGTTGG - Intronic
1113129950 13:107024577-107024599 AGGTTTATGCACATGTGTGTTGG + Intergenic
1113789593 13:113021136-113021158 CTGTGTATACATGTGTGTGTAGG + Intronic
1113870561 13:113557182-113557204 GTGTGTGTGCACATGTGTGTAGG + Intergenic
1113893849 13:113751061-113751083 ATGTATATACACATGTGTGTAGG + Intergenic
1114240092 14:20858939-20858961 GTGTGTGTGCACATGTGGTTTGG + Intergenic
1114670971 14:24410836-24410858 CTGTGTGTACGCATGTGTGTAGG - Intronic
1114788302 14:25626268-25626290 CTGTGTGTGTATGTGTGTGTTGG + Intergenic
1115413292 14:33101136-33101158 GTGTGTGTGCAGGTGTGTGTGGG - Intronic
1115520749 14:34230893-34230915 GTGTGTGCGCATATGTGTGTAGG - Intronic
1116363594 14:44031988-44032010 ATATGGATGCATATGTGTGTTGG + Intergenic
1116530116 14:45960938-45960960 ATGTGTATGTGCATATGTGTGGG + Intergenic
1116559254 14:46357459-46357481 CCATGTATGCACATATGTGATGG + Intergenic
1116751329 14:48889200-48889222 ATATATATGCACGTGTGTGTGGG + Intergenic
1116764583 14:49054406-49054428 CTGTTTATGGACCAGTGTGTTGG - Intergenic
1117622922 14:57606597-57606619 CTTTGTATACACTTGTATGTAGG - Intronic
1118080458 14:62352607-62352629 ATGTGTATGTGCATATGTGTGGG - Intergenic
1118323388 14:64766268-64766290 GTGTGCATGCATGTGTGTGTGGG + Intronic
1118438399 14:65791550-65791572 ATGTGTATGTACGTGTGTGGTGG + Intergenic
1118629913 14:67693532-67693554 GTGTGTATGTGCATGCGTGTGGG - Intronic
1118995778 14:70834402-70834424 GTGCATATGCACGTGTGTGTGGG - Intergenic
1119272572 14:73321811-73321833 CTATGTATGTATATATGTGTAGG + Intronic
1119377665 14:74207574-74207596 GTATGTATGCACATGTGTGCAGG - Intergenic
1119635874 14:76273067-76273089 CTCTGTGTGTGCATGTGTGTGGG - Intergenic
1120204765 14:81575754-81575776 CTGTGTATATACGTGTGTATGGG - Intergenic
1120747774 14:88167314-88167336 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1121407264 14:93726842-93726864 GTATGTGTGCATATGTGTGTAGG - Intronic
1121569704 14:94937820-94937842 CTGTGTGTGTATATCTGTGTGGG + Intergenic
1121702238 14:95963270-95963292 GTGTGTATGTGCCTGTGTGTGGG - Intergenic
1121883212 14:97518687-97518709 CTGAGTATGTATATATGTGTGGG - Intergenic
1122421984 14:101583542-101583564 GGGTGTGTGCACGTGTGTGTAGG - Intergenic
1122807483 14:104267360-104267382 GTGTGAGTGCACGTGTGTGTGGG - Intergenic
1122807487 14:104267410-104267432 GTGTGTGTGCACGTGTGTGTGGG - Intergenic
1122834913 14:104425864-104425886 GTGTGTTGGCACATGTGTTTCGG + Intergenic
1122945303 14:105005915-105005937 CTGCGCATGCACATACGTGTAGG + Intronic
1123985832 15:25645081-25645103 CTGTATATGCACAACTGTGCAGG + Intergenic
1124250871 15:28105896-28105918 GTGTGTGTGCATATGTGTTTGGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124250903 15:28106140-28106162 GTGTGTGTGCGCATGTGTGTGGG + Intergenic
1124250912 15:28106207-28106229 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
1124645583 15:31435713-31435735 CTGTGCATACACATGCATGTGGG - Intergenic
1125114397 15:36072362-36072384 ATGTATATGTGCATGTGTGTAGG - Intergenic
1125154352 15:36569236-36569258 CTGTGGATGGACATTTGGGTTGG - Intergenic
1125399469 15:39285050-39285072 CTTTGCATTCACAAGTGTGTGGG + Intergenic
1126783833 15:52160699-52160721 ATGTGTGTGCACATATGTGGAGG - Intronic
1126929858 15:53635430-53635452 TTTTCTATCCACATGTGTGTAGG - Intronic
1127024394 15:54787012-54787034 TTGTGCATGTACATGTGCGTGGG - Intergenic
1127244894 15:57162008-57162030 CGGTGTGTGCACATGTGCATGGG - Intronic
1127526401 15:59796440-59796462 GTGTGTGTGCATGTGTGTGTTGG - Intergenic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1127665848 15:61146443-61146465 GTGTGTATGTGTATGTGTGTTGG - Intronic
1127745928 15:61972482-61972504 GTGTGTATGTGCATGTGTGTTGG + Intronic
1127784077 15:62340779-62340801 ATGTGTATGCATATATGTATAGG + Intergenic
1127962054 15:63897249-63897271 CTGTGTGTGCATGTGTGTGTTGG - Intergenic
1128791300 15:70435975-70435997 CTGTGCATGTCCATTTGTGTGGG + Intergenic
1128944945 15:71813713-71813735 CCATGTGTGCAGATGTGTGTAGG + Intronic
1129276295 15:74447899-74447921 CTGTTTGTGCACATGTGTGGAGG - Intronic
1129477872 15:75798483-75798505 GTGTGTGTGCACGTCTGTGTTGG + Intergenic
1129661484 15:77555349-77555371 GTGTGTGTGCACACGTGTATGGG + Intergenic
1130601923 15:85281441-85281463 GTGTGTGTGCATATGTATGTGGG - Intergenic
1130766986 15:86880733-86880755 GTGTGTGTGCATATGTATGTGGG + Intronic
1130767824 15:86890158-86890180 CTTTTTTTGCACATGTTTGTTGG + Intronic
1130836082 15:87651452-87651474 CTCTGTATGTACACGTATGTGGG + Intergenic
1131062465 15:89412274-89412296 ATGGGTATGCACATATGTGTTGG + Intergenic
1131563263 15:93462644-93462666 CTGTGAGTGCAGAGGTGTGTTGG - Intergenic
1132342929 15:101089442-101089464 ATGTGTGTGCATGTGTGTGTAGG + Intergenic
1132378493 15:101348728-101348750 CTGTTTCTGCACGTGTGTGATGG - Intronic
1132505458 16:306156-306178 GTGTGTGTGTACGTGTGTGTGGG - Intronic
1132710545 16:1264322-1264344 GTGTGTGTGCATACGTGTGTGGG + Intergenic
1132764633 16:1528022-1528044 CCGTGTGTCCGCATGTGTGTGGG + Intronic
1133012910 16:2924861-2924883 CTGTTGAAGCACATGTGTCTTGG + Intronic
1133039218 16:3051174-3051196 GTGTGTGTGCACGTGTGTGTGGG + Intronic
1133843875 16:9436471-9436493 CGGTGTAAGCACTTGTGGGTGGG - Intergenic
1134147676 16:11779786-11779808 GTGTGTGTGTACACGTGTGTGGG + Intronic
1134254696 16:12601487-12601509 CTGTGTATGGCCAGGTGTGCTGG - Intergenic
1134858871 16:17543140-17543162 ATGCATATGCACATGTGTGCAGG + Intergenic
1135397155 16:22139940-22139962 ATGGGTGTGTACATGTGTGTAGG - Intronic
1135845394 16:25913902-25913924 ATGTGTGTGCATATGTATGTAGG + Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136282099 16:29220005-29220027 ATGTATATTCACATGTGTGAGGG - Intergenic
1137239782 16:46646210-46646232 CTTTTTATTCACATGTTTGTTGG - Intergenic
1137358732 16:47792544-47792566 TTGTTTATGCAGATGCGTGTAGG + Intergenic
1137458384 16:48635773-48635795 GTGTGTATGTGCGTGTGTGTGGG + Intergenic
1137630123 16:49937301-49937323 CTGTGGATGCATTTGTGTGTGGG - Intergenic
1137731299 16:50692746-50692768 GTGTATGTGCACGTGTGTGTTGG + Intergenic
1137731313 16:50692859-50692881 GTGTGTGTGCACGTGTGTGTTGG + Intergenic
1138927578 16:61611165-61611187 GTGTGTATGCATGTGTGTTTTGG - Intergenic
1139328805 16:66171880-66171902 GTGTGTGTGCATGTGTGTGTAGG + Intergenic
1139722400 16:68867080-68867102 CTGTGTCTTCACATCTGTGCAGG - Exonic
1140647923 16:77053261-77053283 TTGTGTATGTTTATGTGTGTTGG + Intergenic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141520919 16:84578662-84578684 GTGTGTGTGCACACTTGTGTGGG - Intronic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141928899 16:87187511-87187533 GTATGTGTGTACATGTGTGTGGG + Intronic
1141928978 16:87188164-87188186 GTGTATGTGTACATGTGTGTAGG + Intronic
1141983418 16:87563864-87563886 TTGTGTGTGCGCGTGTGTGTTGG + Intergenic
1141983451 16:87564282-87564304 ATGTGTGTGCGCATGGGTGTTGG + Intergenic
1142289888 16:89188911-89188933 GTGTGTGGGCACCTGTGTGTGGG - Intronic
1142289902 16:89189006-89189028 GTGTGTGGGCACCTGTGTGTGGG - Intronic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1142321322 16:89384833-89384855 GTGTGTAAGAACATGTGTGTGGG + Intronic
1142381466 16:89734713-89734735 CTGCCTTTTCACATGTGTGTAGG + Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1142410627 16:89914482-89914504 TTGTGTGTGCGCCTGTGTGTGGG + Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144356178 17:14448558-14448580 GTGTGTGTGGACTTGTGTGTTGG - Intergenic
1144411917 17:15010011-15010033 ATGTGTATTCACAGGTGTGTTGG - Intergenic
1144461902 17:15465122-15465144 CTGTGTTTGTATCTGTGTGTTGG - Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146134963 17:30311585-30311607 CTGTATATGTACATATATGTGGG + Intergenic
1146227033 17:31075894-31075916 GTGTGTATGCATCTGTGTGTTGG - Intergenic
1146227947 17:31083496-31083518 GTGTGTATGCACATGAATGCAGG - Intergenic
1146290413 17:31602711-31602733 GTGTGCAAGCACGTGTGTGTGGG - Intergenic
1146341971 17:32027469-32027491 CTGTGTGTGTGCTTGTGTGTGGG + Intronic
1146446985 17:32939966-32939988 CTGTGTATGCGCATGTCTGGTGG - Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146553541 17:33803329-33803351 CTGTGTATGTGTATATGTGTGGG + Intronic
1146733021 17:35212150-35212172 CTGTGTATGAGCAAGTGTGTTGG + Intergenic
1146913313 17:36661853-36661875 CTACGCACGCACATGTGTGTGGG - Intergenic
1146913320 17:36661961-36661983 CTCTGCATGCACATGTGTGTGGG - Intergenic
1146926016 17:36745989-36746011 GTGTGTGTGCTCATGTGTGGGGG - Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147747668 17:42705242-42705264 CTGGATGTGCACATGTGTGGTGG + Intronic
1147956542 17:44138454-44138476 GTGTATGTGCGCATGTGTGTGGG - Intergenic
1148029173 17:44608210-44608232 GTATGTACCCACATGTGTGTGGG - Intergenic
1148228361 17:45915394-45915416 GTGTGCATGAGCATGTGTGTGGG + Intronic
1148552511 17:48558904-48558926 GTGTGTGTGCCCATGTGTGTAGG + Intronic
1148682076 17:49479944-49479966 CTGTGTGTGTTTATGTGTGTTGG - Intergenic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1149347743 17:55754920-55754942 GTGTGTATACATATGTGTGGCGG - Intronic
1150446403 17:65230103-65230125 CTGGGTATGGGCATGGGTGTAGG - Intergenic
1150485159 17:65538128-65538150 ATGTGTATGCGCATGTGCATGGG - Exonic
1151200408 17:72463776-72463798 CTGAAAATGCAAATGTGTGTTGG - Intergenic
1151566833 17:74903188-74903210 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
1152034293 17:77862407-77862429 GTGTATGTGCACATGTGTGGTGG - Intergenic
1152191895 17:78893225-78893247 GTGTGTGTGCATGTGTGTGTAGG + Intronic
1152387308 17:79982516-79982538 CTGTGTGTGCACGTGTGTACAGG + Intronic
1152533882 17:80939328-80939350 GTGTGCACGCACATGTGGGTTGG - Intronic
1152582010 17:81170010-81170032 ATGTGTATGTGCATATGTGTAGG + Intergenic
1152582016 17:81170114-81170136 ATGTGTAGGCATGTGTGTGTTGG + Intergenic
1152855055 17:82660541-82660563 GTGTGTGTACACGTGTGTGTAGG - Intronic
1152855059 17:82660610-82660632 GTGTGTGTGCACGTGTGTGCAGG - Intronic
1153061207 18:996970-996992 CTTTGTATGTAGGTGTGTGTTGG - Intergenic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153363429 18:4225000-4225022 GTGTGCATGCATGTGTGTGTGGG - Intronic
1153943378 18:9996049-9996071 ATGTGCATGCACGTGTGTGTTGG + Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155234691 18:23807490-23807512 CTGTGTGTGTATGTGTGTGTAGG + Intronic
1155553666 18:26994548-26994570 TTGTGTATCCACTTGAGTGTGGG + Intronic
1155633040 18:27918037-27918059 GTGTGTGTGCACATGTTTTTTGG + Intergenic
1155843713 18:30678852-30678874 ATGTGTATGCATGTGTGTGTGGG - Intergenic
1156480831 18:37435355-37435377 GTGTGTGTGCACGTGTGTCTTGG + Intronic
1156499195 18:37546221-37546243 GAGTGTATGCAAGTGTGTGTGGG - Intronic
1156755798 18:40523618-40523640 ATGTATATGCACATGTTGGTGGG - Intergenic
1157131770 18:45013915-45013937 CTGTGTATTCCCAAGTGTCTTGG - Intronic
1157300500 18:46475620-46475642 ATGTGTGTGTACATGAGTGTGGG - Intergenic
1157498813 18:48175499-48175521 CAGTGTATGTGCATGTGTATGGG + Intronic
1157605033 18:48920991-48921013 CTGTGTGTGCACGCGTGTGCAGG - Exonic
1157670109 18:49521136-49521158 GAGTGTGTGCACATGTGTTTGGG - Intergenic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1158468286 18:57711476-57711498 CTGTTTCTGCATATGTGTATGGG + Intronic
1159677215 18:71299819-71299841 CTGTGTGTATATATGTGTGTGGG + Intergenic
1159966811 18:74602956-74602978 CTGAGCATGCCCAGGTGTGTGGG + Intronic
1159980355 18:74770727-74770749 GTTTGTATGCATGTGTGTGTGGG + Intronic
1160623349 18:80186545-80186567 CTGTGTGTGCATGTGTGTGAGGG - Intronic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1160699608 19:499509-499531 CTGTGTTTGTACACGCGTGTGGG - Intronic
1161265604 19:3362298-3362320 TTGTGTCTGCACTTGTGTGGGGG + Intronic
1161618934 19:5288329-5288351 CTGTGTGCACATATGTGTGTAGG - Intronic
1161755745 19:6132744-6132766 ATGTGTGTGCATATGTGAGTGGG + Intronic
1161755749 19:6132814-6132836 ATGTGTGTGCATATGTGAGTGGG + Intronic
1161931946 19:7346526-7346548 CTGTGAGTCCACATGTGTGTCGG + Intergenic
1164565102 19:29320172-29320194 CTGTGTGTGTATGTGTGTGTGGG - Intergenic
1165192156 19:34073905-34073927 GTGTGTATGTGCATGTGTGCGGG + Intergenic
1165391122 19:35539560-35539582 GTGTGTATTTGCATGTGTGTGGG - Intronic
1166313023 19:41973836-41973858 CTGTGTATGCATAGATGTCTTGG + Intronic
1166518100 19:43462182-43462204 CTTTGAATGGAAATGTGTGTAGG + Intronic
1166641541 19:44498710-44498732 CTGAGGATGCCCAGGTGTGTGGG - Intronic
1167091905 19:47350049-47350071 GTGTGTATGTACATAGGTGTGGG + Intronic
1167103467 19:47417922-47417944 GTGTGTGTGCATGTGTGTGTGGG - Intronic
1167740422 19:51321981-51322003 GTGCGTGTGCACATGTGTGCAGG + Intronic
1168011612 19:53537874-53537896 TTGTGTCTGCACATGCGTGTCGG + Intronic
1168011632 19:53538034-53538056 GTCTGTGTGCACATGCGTGTCGG + Intronic
1168013621 19:53554410-53554432 GTGTGCACGCACATGCGTGTCGG + Intronic
924991836 2:319150-319172 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
925005801 2:442268-442290 CTGTGTGTGCACAGCTGTGGGGG - Intergenic
925005882 2:442828-442850 CTGTGTGTGCACAGCTGTGGGGG - Intergenic
925042331 2:741291-741313 TTATGTATGCATATGTGTGGAGG + Intergenic
925365632 2:3309925-3309947 CTGTGTACGCACAGGTGTGCAGG + Intronic
925426764 2:3755351-3755373 GTGTGTATGCATGTGTGTATGGG + Intronic
925904004 2:8528438-8528460 GTGTGTATGAGCATGGGTGTGGG - Intergenic
926293306 2:11548245-11548267 ATGTGTGTGCACATATGTTTGGG - Intronic
926631905 2:15144168-15144190 CTGTGTGTGCATATGTGTTGGGG - Intergenic
926788382 2:16543562-16543584 GTGTGTATGCATATGAGAGTGGG - Intergenic
926906131 2:17807379-17807401 TTGTGTGTGCTCGTGTGTGTTGG - Intergenic
927155777 2:20220350-20220372 GTGTGTGTGCGCATGTGTATGGG - Intronic
927348489 2:22076578-22076600 AAGTGTATGCACATTTGGGTTGG + Intergenic
927839001 2:26425320-26425342 CTGTGAATGGACATTTGGGTTGG + Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928222373 2:29415050-29415072 GTGTGTGTATACATGTGTGTGGG - Intronic
928810859 2:35224121-35224143 TTGTTTATGCACATGTGTATAGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929315853 2:40477751-40477773 GTGTGTGTGCACGTGTGTGTAGG + Intronic
929652012 2:43689368-43689390 CCGTGTATACACATTTGTGAGGG + Intronic
929795786 2:45057395-45057417 GTGTGTGTGTACCTGTGTGTGGG + Intergenic
929880709 2:45835038-45835060 GTGTGTTTGCACACGTGGGTGGG + Intronic
930540434 2:52699199-52699221 ATGTGTGTGCACATGTGTCCTGG + Intergenic
930851053 2:55960801-55960823 ATGTGCATGCATCTGTGTGTAGG - Intergenic
931118466 2:59190286-59190308 CTGTGTGTACATATGTTTGTTGG - Intergenic
931176453 2:59859616-59859638 TTGTGTGTGCATATGTGTGAAGG - Intergenic
931182160 2:59913610-59913632 GTGTGTATGCGTGTGTGTGTGGG + Intergenic
931987416 2:67755305-67755327 ATGTGTATGTGCGTGTGTGTTGG + Intergenic
932224748 2:70030712-70030734 CTCTGTATGTGTATGTGTGTTGG + Intergenic
932239420 2:70145239-70145261 TTGTGTATGCACATGTGGGCTGG + Intergenic
932429029 2:71662571-71662593 TTGTGTGTATACATGTGTGTAGG + Intronic
932865283 2:75335118-75335140 GTATGTGTGCATATGTGTGTGGG - Intergenic
933213677 2:79601051-79601073 GAGTATGTGCACATGTGTGTAGG - Intronic
933242515 2:79938463-79938485 GTGTGTGTGCTTATGTGTGTTGG + Intronic
933320495 2:80770395-80770417 CTATGTATGTGCGTGTGTGTGGG - Intergenic
933694869 2:85210247-85210269 ATGGGGATGCCCATGTGTGTGGG - Intronic
933875225 2:86613836-86613858 TTATGTATGCACGTGTGTCTCGG - Intronic
933876344 2:86624303-86624325 GTGGCTTTGCACATGTGTGTTGG + Intronic
935120720 2:100181309-100181331 GTGTGTATGTACATGTGTTGGGG + Intergenic
935857759 2:107293740-107293762 GTGTGTGTGCACATGTGTGAAGG - Intergenic
936074740 2:109394653-109394675 ATGTGTGTGCACATCTATGTAGG + Intronic
936671124 2:114658126-114658148 ATGTGTGTGCACATGTGCATAGG + Intronic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
936968760 2:118153585-118153607 GTGTGTGTGCACATGTGCTTGGG - Intergenic
937188169 2:120065946-120065968 ATGTGCACACACATGTGTGTTGG - Intronic
937503777 2:122513366-122513388 GTGTGTATGTGGATGTGTGTAGG + Intergenic
937817392 2:126266859-126266881 TTGTGTATGTGCGTGTGTGTTGG - Intergenic
938058651 2:128235213-128235235 CTATGTATGCATATGTGTAGAGG + Intergenic
939118515 2:138088784-138088806 GTGTGTGTGCACAGGTGGGTGGG - Intergenic
939260122 2:139796411-139796433 TTGTGTGTGCATATGTGTGTGGG - Intergenic
940671725 2:156678098-156678120 ATGTGTATGCATGTGTGTATCGG - Intergenic
941469420 2:165865874-165865896 CTGTATATGCATATGTATGTAGG + Intronic
941774585 2:169378540-169378562 CTGTTAAAGCACATATGTGTCGG + Intergenic
942937752 2:181578238-181578260 GTGTGTATATATATGTGTGTGGG + Intronic
943354180 2:186831341-186831363 ATGTGTATGTATACGTGTGTGGG + Intronic
943465269 2:188221228-188221250 GTGTGTATGCATGTGTGTTTGGG + Intergenic
943650725 2:190455007-190455029 ATGTATATGTATATGTGTGTTGG + Intronic
943860440 2:192855328-192855350 ATGTGTATGTGTATGTGTGTGGG - Intergenic
945070225 2:205981929-205981951 CTGTATAAGCACATGTGAGTAGG - Intergenic
946171300 2:217897547-217897569 CTGTGTGTGCATGTGTGTGCTGG - Intronic
946414970 2:219535360-219535382 CTCTGTGTGTACGTGTGTGTGGG + Intronic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
946865898 2:224040278-224040300 CAGAGTGTGCACGTGTGTGTTGG + Intergenic
947515133 2:230797058-230797080 CTGTTGATACACTTGTGTGTTGG + Intronic
947856728 2:233329126-233329148 CTGTGTGTATACACGTGTGTGGG + Intronic
948031962 2:234826102-234826124 GTGCGTGTGCACAGGTGTGTAGG - Intergenic
948354219 2:237364835-237364857 GTGTGGGTGTACATGTGTGTGGG + Intronic
948429530 2:237910209-237910231 CTGTGTGTGTCCCTGTGTGTGGG - Intronic
948429534 2:237910245-237910267 CTGTGTGTGTCCCTGTGTGTGGG - Intronic
948661378 2:239508708-239508730 CTCTGTATGGACGTGTGTGTGGG + Intergenic
948692612 2:239716253-239716275 TTGTGTGTGCATATGTGTGAGGG + Intergenic
948779419 2:240308732-240308754 CTGTGTATGTCTCTGTGTGTGGG + Intergenic
949040322 2:241845088-241845110 CTGCGTCTGCACATGTTTGCCGG + Intergenic
1169228916 20:3874017-3874039 CTGTGGATGGACATTTGGGTTGG - Exonic
1170005495 20:11663884-11663906 GTGTGTGTGCACGTGTGTGAGGG + Intergenic
1170576408 20:17665092-17665114 CTGTGTATACATATATATGTGGG + Intronic
1170900495 20:20457831-20457853 GTGTGGGTGCACATGTGTGCGGG + Intronic
1171030387 20:21671218-21671240 CTGTATATGTGCATGTGTGTGGG - Intergenic
1171051467 20:21863074-21863096 GTGTATTTGTACATGTGTGTGGG + Intergenic
1171249055 20:23634979-23635001 ATGTGTGTGCACATATGTGTGGG - Intronic
1171266186 20:23773821-23773843 CTGTGCATGTACATGTGAGTAGG - Intergenic
1171275938 20:23856458-23856480 TTGTGCATGTACATGTGAGTAGG - Intergenic
1171335076 20:24377539-24377561 TTGTGTATGTATATATGTGTGGG + Intergenic
1171544877 20:25992213-25992235 CTGTGTGTGCGTGTGTGTGTTGG + Intergenic
1172485530 20:35295855-35295877 CTGTGTGTGCATGTGTGTCTGGG + Intergenic
1172800676 20:37574185-37574207 GCGTGTTTGCAAATGTGTGTGGG + Intergenic
1172825675 20:37782367-37782389 GTGTGTGTGCACATATGTGTGGG - Intronic
1173091491 20:39976301-39976323 AGGTGTATGCACATCTGAGTAGG + Intergenic
1174146789 20:48457783-48457805 GTGTGTATGCATGAGTGTGTGGG + Intergenic
1174293204 20:49523924-49523946 CTGTGTGTGCATGTGTATGTAGG - Intronic
1174540830 20:51288136-51288158 CTTTGCATGCTGATGTGTGTGGG + Intergenic
1174638665 20:52023935-52023957 ATGAGAATGCACATGTGTGAAGG - Intergenic
1174864496 20:54122756-54122778 ATGTGTATGCATGTGTGTGTAGG - Intergenic
1174957746 20:55118744-55118766 GTGTATATGTGCATGTGTGTGGG - Intergenic
1175169762 20:57071961-57071983 CTGTGTGTGCACGTATGTGCGGG + Intergenic
1175518483 20:59584414-59584436 GTGTGTATGCATGTGTGTGAGGG + Intronic
1175963832 20:62650244-62650266 CTGTGTGTGCACGTCTGTGTAGG - Intronic
1176106059 20:63388019-63388041 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1177257389 21:18683108-18683130 GTGTGTATGCACATGTGCACGGG + Intergenic
1177975734 21:27848092-27848114 CTCTTTATGCACATCAGTGTGGG - Intergenic
1177989391 21:28019412-28019434 CTGTGTATGCAGCTGTGGTTTGG + Intergenic
1178322662 21:31617214-31617236 GTGTGTGTGTACATGTGTGGCGG - Intergenic
1178429623 21:32508045-32508067 CTGTGTGTGTAAGTGTGTGTTGG + Intronic
1178630009 21:34251495-34251517 ATGTGTGTGCACATGGGTCTGGG + Intergenic
1179026271 21:37681552-37681574 AGGTGTATGCACATGCTTGTTGG + Intronic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179399023 21:41067126-41067148 GTGTGTATGTATGTGTGTGTGGG - Intergenic
1179467290 21:41584779-41584801 GGGTGTATGTATATGTGTGTGGG - Intergenic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179921767 21:44511219-44511241 CTGTGTGTGCAGGTGTGTGCAGG - Intronic
1179921777 21:44511413-44511435 ATGTGTATCCACATGTGTACAGG - Intronic
1180172812 21:46068706-46068728 GTGTGTATGCACGTGTGCCTGGG + Intergenic
1180172839 21:46068990-46069012 GTGTGTATGCACATGTGCCTGGG + Intergenic
1180761569 22:18213644-18213666 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1180774098 22:18410966-18410988 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181070207 22:20329979-20330001 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181132113 22:20738117-20738139 GTGTGTAGGCAGGTGTGTGTAGG + Intronic
1181193201 22:21157916-21157938 GTGTGTATGTGTATGTGTGTGGG + Intergenic
1181216244 22:21334685-21334707 GTGTGTATGTGTATGTGTGTGGG - Intergenic
1181914788 22:26271077-26271099 CTTTGGGTGCACATGTGTCTGGG + Intronic
1182829742 22:33295348-33295370 ATGTGTGTGTACATGCGTGTGGG + Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1183176793 22:36230368-36230390 CCCTGTATGCCCATGAGTGTTGG + Intronic
1183273496 22:36876616-36876638 TTGTGTGTGCATGTGTGTGTGGG - Intronic
1183366156 22:37408143-37408165 CTGTGTATGTATAAATGTGTGGG - Intronic
1183844500 22:40529931-40529953 CTGTGCATGGACAAATGTGTGGG + Intronic
1184491724 22:44813734-44813756 GTGTGTATGTAGGTGTGTGTAGG - Intronic
1184739612 22:46419990-46420012 TTGAGTATGCACATGATTGTGGG - Intronic
1184779436 22:46639320-46639342 GTGTGTGTGCACGTGTGTGGTGG + Intronic
1184833338 22:47005263-47005285 ATGTGTATAGGCATGTGTGTAGG - Intronic
1184833377 22:47005550-47005572 GTTTATATGCATATGTGTGTAGG - Intronic
1184868929 22:47220833-47220855 ATGTGCATGCACATGTGTACAGG - Intergenic
1184893299 22:47392571-47392593 TGGTGTATACACACGTGTGTGGG - Intergenic
949309716 3:2683315-2683337 GTGTGTGTGTACATGTGTGCAGG - Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949646625 3:6102538-6102560 CTGTGGCTGCACATGTATGTAGG - Intergenic
949695334 3:6688217-6688239 CTGTCTATGCACATAGATGTGGG - Intergenic
950457392 3:13100841-13100863 CTTTGTATGCACTTGTTTATGGG - Intergenic
950824645 3:15805000-15805022 CTACGTAAGTACATGTGTGTTGG - Intronic
951296992 3:20949747-20949769 ATCTGGATGCTCATGTGTGTTGG + Intergenic
951729797 3:25797979-25798001 GTGTGTGTGCGCGTGTGTGTAGG - Intergenic
952230334 3:31423071-31423093 ATGTTTGTGCACATGTGCGTTGG - Intergenic
952276583 3:31883187-31883209 CTGTGTCTGCAGGTGTGTGTAGG - Intronic
952761171 3:36915489-36915511 GTGGGAAGGCACATGTGTGTTGG - Intronic
952796136 3:37241155-37241177 CTGTGTTTGTACATATATGTGGG - Intergenic
953004838 3:38968581-38968603 GTGTGTGTGCACATGTGTGTTGG - Intergenic
953404050 3:42651760-42651782 GTGGGTATGCGTATGTGTGTGGG - Intergenic
954153906 3:48674250-48674272 CTGAGTGTACACATGGGTGTGGG + Exonic
954205387 3:49055274-49055296 CTGAGCATGCATATGTTTGTGGG - Intronic
954444009 3:50536903-50536925 GTGTGTATGCATGTGTGGGTGGG - Intergenic
954458933 3:50615389-50615411 ATGTGTGTGCACATGTGTAAAGG + Intronic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955402473 3:58602868-58602890 ATGTGTATATACATGTTTGTGGG + Intronic
955953510 3:64265563-64265585 CTGTGTATGCAGAGATCTGTGGG - Intronic
956186319 3:66565924-66565946 GTGTGTATGCGTGTGTGTGTGGG + Intergenic
956357382 3:68409119-68409141 CTGTACATGTACATGTGTGTGGG - Intronic
956801331 3:72762072-72762094 GTATGTATGTACATGTTTGTGGG - Intronic
957001381 3:74889842-74889864 GTGTGTATGCACGCATGTGTAGG - Intergenic
957029010 3:75218428-75218450 CTGTGTGTGCACAGGTCTGATGG + Intergenic
957046626 3:75379870-75379892 CTGTGTGTGTAAGTGTGTGTTGG - Intergenic
957700559 3:83705709-83705731 ATTTATATGTACATGTGTGTAGG - Intergenic
957795530 3:85000819-85000841 CTATGTATGTACATTTGTATAGG + Intronic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
959732356 3:109618952-109618974 ATGTGTGTGCATGTGTGTGTTGG + Intergenic
959887445 3:111519038-111519060 GTGTGTATGCATGTGTGTGTGGG - Intronic
960051247 3:113241355-113241377 TTGTGTGTGCAGATGTGTGCAGG - Intronic
960085506 3:113586319-113586341 ATGTGTATCCACAGGTGTTTAGG - Intronic
960181482 3:114585468-114585490 CCGTATGTGCACATGTGTGTGGG + Intronic
960446335 3:117753462-117753484 GTGTGTACGTATATGTGTGTCGG + Intergenic
961445404 3:126978669-126978691 GTATGTGTGCACATGTGTGGAGG + Intergenic
961536666 3:127574976-127574998 GTGTCCATGCACATGTGGGTGGG + Intronic
961664009 3:128485351-128485373 CTCTGTATGTGCATGTGTTTGGG - Intronic
961716523 3:128861356-128861378 GTGTGTGAGCACATGTGTGATGG - Intergenic
963005341 3:140721881-140721903 GTGTGTATGTGTATGTGTGTTGG - Intergenic
963145919 3:141994163-141994185 TTGTGTTTGTACATGTGTGTAGG + Intronic
963998745 3:151742017-151742039 CAGTGTATTCACATATGTTTGGG - Intronic
963999968 3:151758829-151758851 ATGAGTATGTGCATGTGTGTGGG + Intronic
964269615 3:154940665-154940687 ATCTGTATGCACATATGGGTTGG - Intergenic
964683163 3:159364890-159364912 CTGTGTGTGCACAGGATTGTTGG + Intronic
965100087 3:164285501-164285523 CAGTGCATACACATGTGTGGAGG - Intergenic
965465249 3:169021666-169021688 GTGTGTGTGCATATTTGTGTGGG - Intergenic
966555543 3:181255713-181255735 GTGTGTGTGCACGTGTGTGTAGG + Intergenic
966758679 3:183395374-183395396 ATGTTTATGCACATATGTGTGGG + Intronic
966923895 3:184632011-184632033 GTGTGTGTGCATGTGTGTGTAGG - Intronic
967449532 3:189608163-189608185 CTGTGTGTGCATGTATGTGTTGG + Intergenic
967988275 3:195112447-195112469 GTGGGTGTGCACATGCGTGTGGG - Intronic
968488096 4:874155-874177 GTGTACATGCACACGTGTGTTGG + Intronic
968489870 4:884219-884241 GTGTGTGTGCACAGGCGTGTGGG + Intronic
968500986 4:950010-950032 CTGTGTATCCGCATGTGGGAGGG - Intronic
968521518 4:1036635-1036657 CAGTGTGTGCTCGTGTGTGTGGG + Intergenic
968706215 4:2079514-2079536 GTGTGTGTGCACGTGTGTGTTGG + Intronic
968909216 4:3468368-3468390 CTGTGTGTGCAAGTGTGTGCCGG + Intronic
968933877 4:3599920-3599942 GTCTGTATGCATCTGTGTGTGGG + Intergenic
968950051 4:3685958-3685980 ATATGTGTGCACACGTGTGTGGG - Intergenic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969301415 4:6299480-6299502 GTGGGTGTGCACGTGTGTGTAGG + Intronic
969335978 4:6510541-6510563 GTGTGCATGCACATGCATGTGGG - Intronic
969410886 4:7027410-7027432 CTGTGTATGTGTAGGTGTGTGGG - Intronic
969510720 4:7616276-7616298 GTGTGTATGTATATGTGAGTGGG - Intronic
969706081 4:8792657-8792679 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
972019790 4:34297633-34297655 TTGTGTATGTGTATGTGTGTGGG + Intergenic
972114594 4:35615068-35615090 TTGTGTATACACATATATGTAGG + Intergenic
972711584 4:41601554-41601576 ATGTGTAAGGACATGTGTGGTGG + Intronic
972956397 4:44397428-44397450 GTGTGCATGCATGTGTGTGTGGG + Intronic
973110982 4:46397546-46397568 TTGTGTATGCACTTGTCTTTTGG + Intronic
973166396 4:47083336-47083358 GTGTGCATGCACATGTGTAATGG - Intronic
974139705 4:57869816-57869838 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
974483443 4:62475496-62475518 CTCTGTGTACACAGGTGTGTAGG - Intergenic
974756497 4:66215664-66215686 GTGTGTGTGCATATGTGTGTTGG - Intergenic
975601782 4:76107941-76107963 TTGTGTGTGCATGTGTGTGTTGG + Intronic
976010253 4:80477880-80477902 CTCTGTAAGCACAGGTGTGGAGG - Intronic
976418180 4:84803626-84803648 GTGTGTGTCCGCATGTGTGTGGG + Intronic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
977132967 4:93266469-93266491 CTGTGTGTGTATGTGTGTGTGGG - Intronic
977540173 4:98308269-98308291 GTGTGTATATATATGTGTGTGGG - Intronic
977608039 4:99002584-99002606 TTGTGTGTGCATGTGTGTGTGGG + Intronic
978024573 4:103856568-103856590 GTGTGCATGCATGTGTGTGTGGG + Intergenic
978202883 4:106043753-106043775 GTGTGTATGTATATCTGTGTGGG + Exonic
978292207 4:107154769-107154791 GTGTGTATGGATATATGTGTGGG - Intronic
978558266 4:110004195-110004217 GTATGTATGCCCATGTATGTTGG - Intronic
979098940 4:116590187-116590209 TTGTGTATGTATATGTGTTTAGG - Intergenic
979122107 4:116916579-116916601 CTGTGTTTGTATATGTGTTTAGG + Intergenic
979279258 4:118846911-118846933 CTGTGTGTGTCCGTGTGTGTGGG - Intergenic
980441571 4:132853904-132853926 GTGTGTATGCATACATGTGTAGG - Intergenic
980474499 4:133294881-133294903 ATGTATATGTATATGTGTGTGGG + Intergenic
980474500 4:133294943-133294965 GTGTGTGTGCACATGTGTGTTGG + Intergenic
981095082 4:140770673-140770695 GTGTGTGTACACTTGTGTGTAGG + Intergenic
981806034 4:148716176-148716198 ATGTGCATGCAAAGGTGTGTGGG - Intergenic
981999869 4:151012569-151012591 TTGTGTGTGCGCATGTGTGTGGG - Intronic
982317154 4:154043613-154043635 CTGTGTATTCCCATTTGTCTGGG + Intergenic
982484241 4:155948391-155948413 GTGTGTGTGCACATGTGTACTGG + Intronic
982780512 4:159486237-159486259 GTGTATATGTACATGTGTATGGG - Intergenic
983280132 4:165670321-165670343 CTGTGTGTGTATGTGTGTGTAGG + Intergenic
983837818 4:172414353-172414375 CTGTGTATACACATATAAGTTGG - Intronic
984230213 4:177088143-177088165 GTGTATATGAATATGTGTGTGGG - Intergenic
984461803 4:180046521-180046543 GTGTGAATACATATGTGTGTGGG + Intergenic
984579564 4:181495687-181495709 GTGTGTATGCCCCTGTGTGCAGG + Intergenic
984587831 4:181583005-181583027 GTGTGCATGCACATGTGTGTGGG - Intergenic
984699376 4:182808659-182808681 GTGTGCACGCACATGTGGGTGGG + Intergenic
984806357 4:183755254-183755276 CTGTGTGTACACATATGTGTTGG + Intergenic
985515986 5:344803-344825 CTGTGTGTGCGGGTGTGTGTGGG + Intronic
985674083 5:1221414-1221436 GTGTGTGTGCCCATGTGTGTGGG - Intronic
985702430 5:1381733-1381755 GGGTGTGTGCACAGGTGTGTGGG - Intergenic
985706172 5:1402577-1402599 CTCCGTGTGCACGTGTGTGTGGG - Intronic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985833784 5:2256074-2256096 CTCTGTATGTGCATGTGTGTGGG + Intergenic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
985958228 5:3280547-3280569 CTGTGTATGCATGTGTGCCTAGG - Intergenic
985982476 5:3482408-3482430 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
985982478 5:3482434-3482456 GTGTGTATGCATGTGTATGTGGG - Intergenic
986034405 5:3924337-3924359 CTGAGTGTGTTCATGTGTGTGGG + Intergenic
986124338 5:4871317-4871339 CTGTGTATTCACAGGTGGGGAGG + Intergenic
986131061 5:4930669-4930691 GTGTGTATGCATGTGTGTATAGG + Intergenic
986251301 5:6060848-6060870 ACGTGTGTGCACATGTGTGCGGG - Intergenic
986282742 5:6336900-6336922 GTGTGTGTGCACGTGTGTGCTGG - Intergenic
986615964 5:9617849-9617871 CCGAGTATGTACATGTGTGCTGG - Intergenic
986799015 5:11240615-11240637 GTGTGTATGTACGTCTGTGTTGG - Intronic
987542044 5:19268780-19268802 GTGTGTATGTATCTGTGTGTGGG - Intergenic
987691853 5:21277174-21277196 TTGTATATGCATATGTATGTAGG - Intergenic
987761288 5:22165473-22165495 ATGTGTATGTGTATGTGTGTTGG - Intronic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989137213 5:38167306-38167328 GTGCGTGTGCACATGTGTGCGGG + Intergenic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
989349307 5:40467681-40467703 CTGTGAATCCATATGTGTTTAGG - Intergenic
989719721 5:44510488-44510510 TTGTGTGTGTACTTGTGTGTAGG + Intergenic
989818405 5:45764723-45764745 CTGTGTTTGCAGTTGTGTATCGG + Intergenic
990352292 5:54930970-54930992 CTGTTTTGGCACATCTGTGTGGG - Intergenic
990726541 5:58761637-58761659 GTGAGTGTGTACATGTGTGTGGG - Intronic
990978183 5:61577239-61577261 ATGTGTGTACCCATGTGTGTTGG + Intergenic
990991399 5:61687860-61687882 CTGTGTATGTCCTTGTGTGGTGG - Intronic
991213630 5:64135403-64135425 TTGTATATGTATATGTGTGTAGG - Intergenic
991395659 5:66202519-66202541 ATGTGTATGTGCACGTGTGTGGG - Intergenic
991511104 5:67376981-67377003 CTGGGTCTGCACATGTCTGCAGG - Intergenic
991748531 5:69772934-69772956 TTGTATATGCATATGTATGTAGG + Intergenic
991800111 5:70352779-70352801 TTGTATATGCATATGTATGTAGG + Intergenic
991828489 5:70657260-70657282 TTGTATATGCATATGTATGTAGG - Intergenic
991892466 5:71352206-71352228 TTGTATATGCATATGTATGTAGG + Intergenic
991896079 5:71398927-71398949 ATGTGTATGTGTATGTGTGTTGG - Intergenic
992166167 5:74054120-74054142 CTGTGTTTGCACATCTGTGGTGG + Intergenic
992439387 5:76785059-76785081 GTGTGTATGCACATGAGGCTAGG - Intergenic
993206265 5:84883484-84883506 GTGTGTATGTATGTGTGTGTTGG + Intergenic
993456372 5:88131679-88131701 TTGTTTATGCAAATGAGTGTAGG + Intergenic
993547947 5:89236057-89236079 GTGTGTATGTGTATGTGTGTGGG + Intergenic
993818815 5:92588255-92588277 GTGTTTATGTATATGTGTGTGGG + Intergenic
993831142 5:92759597-92759619 TTGTGTGTGTATATGTGTGTTGG + Intergenic
993961518 5:94303048-94303070 GTGTATATGCAATTGTGTGTTGG - Intronic
994082010 5:95717399-95717421 ATATGTGTGCATATGTGTGTGGG + Intronic
994283629 5:97937790-97937812 TTGTTTATGCAGATGAGTGTAGG - Intergenic
994851667 5:105062434-105062456 GTGTGTGTGCACATGTGTGCAGG + Intergenic
995075778 5:107981341-107981363 CTGTTTCTGCACATCTGTGCTGG + Intronic
995397228 5:111699780-111699802 ATGTGTATGTATATGTTTGTGGG + Intronic
995611804 5:113918537-113918559 ACATGTATGCACATATGTGTGGG - Intergenic
996300266 5:121973596-121973618 ATGTGTGTGCATGTGTGTGTGGG + Intronic
996313675 5:122137141-122137163 ATGTGTATGTGCATGTGTATGGG + Intronic
996596685 5:125211204-125211226 ATATGTATTCACATATGTGTTGG + Intergenic
996911817 5:128665352-128665374 GTATGAATGCACATGTGTGGAGG - Intronic
997184211 5:131865702-131865724 GTGTGTATGTGCATATGTGTTGG + Intronic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998363944 5:141616536-141616558 CTGTGTATGTATACGTGGGTGGG - Intronic
998392652 5:141797287-141797309 CTGTGTGTGGATATCTGTGTTGG - Intergenic
998542769 5:142998497-142998519 CTGTGTTTGTAAATGTATGTTGG + Intronic
998728778 5:145049793-145049815 GTGTGTATATATATGTGTGTGGG + Intergenic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999430991 5:151525305-151525327 TATTGTATGCACATGTGTGTAGG - Intronic
999826481 5:155278270-155278292 TTGTGTATGCATGTGTGTGTGGG - Intergenic
999911000 5:156199060-156199082 GTGTGTATCTACATGTGTTTAGG - Intronic
999966356 5:156813977-156813999 CTGTGTTTTCACATGTATTTAGG - Intergenic
1000367380 5:160504414-160504436 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1000760147 5:165213498-165213520 GTGTATGTGCACATGTGTGCTGG - Intergenic
1000895228 5:166847273-166847295 TTGTGTGTGCACGTGTGTGTTGG + Intergenic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001844985 5:174914496-174914518 GTGTGTGTGCACGTGTGTGTTGG - Intergenic
1002778585 6:349213-349235 GTGTGAGTGCACTTGTGTGTGGG + Exonic
1002923125 6:1587345-1587367 GTGTGTCTGCTTATGTGTGTGGG + Intergenic
1002997014 6:2296504-2296526 TTATGTATACATATGTGTGTGGG + Intergenic
1003603309 6:7538647-7538669 GTGTGTATGTGCATGTGTGTGGG + Intergenic
1003893902 6:10588851-10588873 GTGTGTATGTGTATGTGTGTGGG + Intronic
1004744377 6:18495394-18495416 CTGTGAAGGAACATCTGTGTTGG + Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1004948482 6:20641836-20641858 GTGTGTGTACACATGTGTATGGG + Intronic
1006774440 6:36581075-36581097 GTGTGTGTGCATGTGTGTGTCGG + Intergenic
1007384262 6:41510049-41510071 ATGTGTGTGTACGTGTGTGTTGG - Intergenic
1007458594 6:42000050-42000072 GTGTGTGTGCATATGTGTATTGG + Intronic
1007698927 6:43754045-43754067 GTGTGTGTGCATGTGTGTGTAGG + Intergenic
1008426734 6:51367208-51367230 GTGTGTATGAATGTGTGTGTAGG + Intergenic
1009355099 6:62733773-62733795 TTTTGTATGCACAGGTGTGAGGG - Intergenic
1009457310 6:63872320-63872342 GTGTGTGTGCACAAGTGTGTAGG + Intronic
1009621681 6:66085431-66085453 CTGAGAATGCTCCTGTGTGTTGG - Intergenic
1010923185 6:81710135-81710157 GTGTGTATATATATGTGTGTGGG + Intronic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012020422 6:93911074-93911096 CTATGTATTCACATGTGTTTTGG + Intergenic
1012101236 6:95087667-95087689 ACGTGTATACACATGTGTGAGGG - Intergenic
1012357634 6:98335644-98335666 ATGAGTGTGCAAATGTGTGTAGG - Intergenic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014499480 6:122167487-122167509 CTATGTGTGTATATGTGTGTTGG + Intergenic
1014785908 6:125619046-125619068 GGGTGTATGCACATGTGTGTGGG + Intergenic
1016212817 6:141560861-141560883 GTGGGTATGCATGTGTGTGTGGG + Intergenic
1017381227 6:153832921-153832943 GTGTGTATGCATGTGTGTGCAGG - Intergenic
1017769022 6:157630776-157630798 CTGTGTAAGGGTATGTGTGTGGG - Intronic
1017908281 6:158771669-158771691 GTGTGTGTGCAGTTGTGTGTGGG + Intronic
1018329446 6:162711522-162711544 CTGTGTTTGCACAGGTCTGAGGG - Intronic
1018638525 6:165885825-165885847 ATGTGTATGCATATGTGTGTTGG + Intronic
1018698510 6:166408993-166409015 GTGTGTGTGCACAGGTGTGTGGG - Intergenic
1018698518 6:166409145-166409167 GTGTGTATGTACATATGTGTAGG - Intergenic
1018816712 6:167337756-167337778 GTGTGTGTGCATGTGTGTGTAGG - Intronic
1018837373 6:167495415-167495437 GTGTGTATAAGCATGTGTGTAGG - Intergenic
1018854360 6:167664912-167664934 ATGTGTGTGCACATGCATGTGGG + Intergenic
1019059658 6:169247361-169247383 GTTTGTATACACATGTGTGATGG + Intronic
1019075050 6:169380199-169380221 GTGTGTATGCGTATGTATGTAGG + Intergenic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019819575 7:3232229-3232251 GTTTATATGCATATGTGTGTGGG + Intergenic
1020074709 7:5250213-5250235 GTGTGTGTGCATGTGTGTGTGGG + Intergenic
1020557301 7:9686455-9686477 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021464083 7:20922053-20922075 GTGTGTGTGCACGTGTGTGTGGG + Intergenic
1021485896 7:21168232-21168254 CTACGTGTGCACGTGTGTGTGGG + Intergenic
1022019038 7:26380717-26380739 GTGTGTATGCATCTCTGTGTAGG + Intergenic
1022417957 7:30194469-30194491 ATGTGTTTGTACAGGTGTGTAGG + Intergenic
1022562852 7:31368019-31368041 GTGTGTGTGCGTATGTGTGTGGG + Intergenic
1022769722 7:33456033-33456055 ATGTGTGTGCACATGCGTGTAGG - Intronic
1022957805 7:35397505-35397527 GTGTGTGTGCACATGTGTGTGGG + Intergenic
1023296686 7:38722206-38722228 GTGTGTATACATATGTGTGTGGG - Intergenic
1023379372 7:39591105-39591127 CTTTGTGTGCACATGTGTTGGGG + Intronic
1023867753 7:44246394-44246416 ATGTGTGTGCACTTGTGTGTTGG - Intronic
1023935540 7:44737347-44737369 CTGGGTATGGACATGGGTGGGGG + Intergenic
1024013764 7:45293027-45293049 GTGTATATGCACGTGTGTGATGG + Intergenic
1024352725 7:48383349-48383371 GTGTGTGTGCATATGTATGTGGG + Intronic
1024645446 7:51367059-51367081 CTCTGCATGGACCTGTGTGTTGG + Intergenic
1025296277 7:57777278-57777300 CTGTGTGTGCGTGTGTGTGTTGG + Intergenic
1025855377 7:65271974-65271996 CTATTTTTTCACATGTGTGTTGG - Intergenic
1026231824 7:68490507-68490529 ATTAGTATGCATATGTGTGTGGG - Intergenic
1026567071 7:71497997-71498019 ATGTGTATGCACATGCGTGTGGG + Intronic
1026975666 7:74496431-74496453 GTGTGTATGCATTTGAGTGTGGG + Intronic
1026982056 7:74532680-74532702 CTGTGGATCCAGATGTGTGGGGG + Intronic
1027052099 7:75027051-75027073 CTGTGTGTGCACACGTGTATGGG + Intergenic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1027882773 7:83862976-83862998 CTATTTATTCACATGTCTGTTGG + Intergenic
1028079623 7:86558726-86558748 TTGTATATGGACATTTGTGTTGG + Intergenic
1028097887 7:86784933-86784955 CTGTGTATGAACTTGGCTGTTGG + Intronic
1028224179 7:88230921-88230943 CTGTGTGCGTGCATGTGTGTGGG - Intergenic
1028440243 7:90851349-90851371 GTGTGTATGAATGTGTGTGTGGG + Intronic
1028844786 7:95467602-95467624 ATGTTTTTGCACATGTGTGTAGG - Intergenic
1028872734 7:95786880-95786902 CTGTATATGGACATGTGTGTGGG + Intronic
1029051223 7:97690225-97690247 CTCAGTGTGCATATGTGTGTGGG - Intergenic
1029052703 7:97705616-97705638 CTGGGTGTGCATATATGTGTTGG - Intergenic
1029697556 7:102224126-102224148 CTGTGCATGCAGATGTCTGTTGG + Intronic
1029842498 7:103380996-103381018 GTGTGTATGCATGTGTGTGGGGG - Intronic
1029852135 7:103473608-103473630 GTGTGTATGTACATATGTGGGGG - Intronic
1029863297 7:103598928-103598950 GTGTGTGTGCGCATATGTGTTGG + Intronic
1029888883 7:103905554-103905576 ATGTGTCTGCACAAGTGTTTGGG - Intronic
1029987193 7:104933313-104933335 ATGTGTATGTACGTGTGCGTAGG - Intergenic
1030167173 7:106566930-106566952 CTGTGTGTGTACATCTGTATGGG - Intergenic
1030908576 7:115217164-115217186 GTGTGTCTGCACGTGTGTTTAGG - Intergenic
1031783581 7:126000284-126000306 GTGTGTATGCACATGTGCTCAGG - Intergenic
1031814741 7:126419905-126419927 CTGTGTGTGTCTATGTGTGTGGG - Intergenic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1032425124 7:131816443-131816465 CTGTGTAAACACATGTGTATGGG + Intergenic
1032470731 7:132176796-132176818 GTGAGTGTGCATATGTGTGTTGG + Intronic
1033638053 7:143230915-143230937 GTGTGTATGTGAATGTGTGTTGG - Intergenic
1033638060 7:143231046-143231068 GTGTGTATGAATGTGTGTGTTGG - Intergenic
1033642915 7:143279423-143279445 CAGTTTAAGCACATGTGTTTTGG - Intergenic
1033803462 7:144927833-144927855 ATGTGTATTCACATTTCTGTTGG + Intergenic
1033820088 7:145124866-145124888 GTGTGTGTGGGCATGTGTGTGGG + Intergenic
1033907405 7:146222572-146222594 GTGTGCGTGCACATGTATGTAGG + Intronic
1033982943 7:147188231-147188253 ATGGGTTTGCAGATGTGTGTGGG + Intronic
1034402606 7:150874927-150874949 GTGTGTGTGCATGTGTGTGTGGG - Intergenic
1034823028 7:154234668-154234690 GTGTGTGTGCATGTGTGTGTTGG - Intronic
1034869549 7:154671851-154671873 GTGTGTGTGCATGTGTGTGTTGG - Intronic
1034895513 7:154873897-154873919 GTGTGTGTGCCTATGTGTGTGGG - Intronic
1035226135 7:157433461-157433483 GGGTGTGTGCACATGTGGGTGGG - Intergenic
1035325331 7:158062334-158062356 CAGTCAGTGCACATGTGTGTGGG + Intronic
1035432439 7:158832142-158832164 ATGTGTGTGCACACATGTGTAGG + Intergenic
1035657489 8:1320885-1320907 GTCTGTATGCACAGGTGTGTAGG + Intergenic
1035704259 8:1663073-1663095 GTGCGTTTGTACATGTGTGTGGG + Intronic
1035780691 8:2225424-2225446 GTGTGTATGCCTGTGTGTGTAGG - Intergenic
1035877416 8:3206523-3206545 GTGTGTATGTATGTGTGTGTGGG + Intronic
1035907031 8:3523542-3523564 ATCTGTGTGCACATGTGTCTGGG - Intronic
1035941382 8:3905072-3905094 ATGTGTATCCAAATGTCTGTAGG + Intronic
1036097179 8:5737217-5737239 ATATGTATGCATGTGTGTGTGGG - Intergenic
1037431855 8:18821840-18821862 ATGTGTGTGCATGTGTGTGTGGG - Intronic
1037692778 8:21196731-21196753 GTGTGTATACACACGTGTATAGG - Intergenic
1037716669 8:21406853-21406875 GTGTGTATATGCATGTGTGTGGG + Intergenic
1038126358 8:24677550-24677572 CTGTGTATGTGTTTGTGTGTTGG - Intergenic
1038485097 8:27929392-27929414 CTGGGTAGGTACATGTGTATGGG + Intronic
1038848244 8:31249706-31249728 CTGTGTATGCATGTGTGAATTGG + Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039784451 8:40820789-40820811 CTGTGTGTGTATATATGTGTGGG + Intronic
1039954580 8:42197208-42197230 GTGTGTAGGCACCTGTGTGTAGG + Intronic
1040619736 8:49078309-49078331 CTGTGTGTGCAAATGTGGGAGGG - Intergenic
1041372754 8:57180571-57180593 ATGTGTGTACACATGTGTGTTGG + Intergenic
1042337137 8:67640550-67640572 CTGGGTCTGCACCTGTGGGTTGG + Intronic
1042521252 8:69713504-69713526 GTGTGTATGCAGTTGTTTGTGGG - Intronic
1042937995 8:74079901-74079923 ATGTGCATGCAGATGTGTGCAGG + Intergenic
1043126543 8:76403684-76403706 GTGTGTGTGCATATGTATGTGGG - Intergenic
1043160582 8:76841573-76841595 GAGTGTATGCAAATGTGTGTCGG + Intronic
1043389263 8:79776369-79776391 GTGTGTATGCACATGTGTGTGGG - Intergenic
1043495382 8:80795102-80795124 CTGTGTGTGCGCTTGTGTGAGGG - Intronic
1043696683 8:83228226-83228248 TTGTGTGTGTCCATGTGTGTGGG + Intergenic
1044113207 8:88302618-88302640 ATAGGTATGCATATGTGTGTAGG + Intronic
1044530239 8:93299371-93299393 CTAAATATGCACGTGTGTGTGGG + Intergenic
1044546335 8:93464650-93464672 CTGTGTGTGCACGCGTGTATGGG - Intergenic
1044796642 8:95907307-95907329 ATATGTATGTATATGTGTGTAGG - Intergenic
1045350042 8:101330088-101330110 GTGTATACGCACATGTGTGAGGG - Intergenic
1045361419 8:101437202-101437224 CTGTGCGTGCACATGCCTGTCGG + Intergenic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1046147364 8:110178472-110178494 GTGTGTATGCATATGTGTAGAGG + Intergenic
1046207878 8:111026273-111026295 GTGTGCATGCATATGTATGTAGG + Intergenic
1046363636 8:113195842-113195864 CTATATATGCATGTGTGTGTGGG - Intronic
1046739020 8:117809171-117809193 GTATGTATGTGCATGTGTGTAGG + Intronic
1046759263 8:118004303-118004325 TTGTGTATGCACGTGCATGTGGG + Intronic
1046822358 8:118648385-118648407 TTATGAATGCATATGTGTGTGGG + Intergenic
1047014340 8:120707261-120707283 TTGTGTGTGCACATATGTTTGGG - Intronic
1047123053 8:121927910-121927932 CTGTGTAGTCACATGTCTTTGGG - Intergenic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1047676228 8:127206147-127206169 TTATGTATGTATATGTGTGTGGG + Intergenic
1047689688 8:127339150-127339172 CTGTGTATGAAGATATGTGCAGG + Intergenic
1048169454 8:132091742-132091764 CAGTGTTGGCACATGTGAGTGGG + Intronic
1048379179 8:133849220-133849242 GTGTGCATGCGCATGTGTGGTGG + Intergenic
1048635124 8:136287062-136287084 CTGTGTCCTCACATGTGTGAAGG - Intergenic
1048865371 8:138757034-138757056 GTGTGTGTGCACGTGTGTGCAGG - Intronic
1049163365 8:141111690-141111712 CTGTTTCTGCACCTGTCTGTTGG + Intergenic
1049305526 8:141900953-141900975 CTGTGTATGTGTAAGTGTGTGGG + Intergenic
1049339068 8:142102247-142102269 CTGGGGGTGCACAGGTGTGTGGG + Intergenic
1049423737 8:142528126-142528148 GTGTGTGTGCCCATGCGTGTGGG - Intronic
1049525451 8:143123719-143123741 GGGTGTGTGCACATGTATGTGGG - Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049525582 8:143125124-143125146 GGGTGTATGTACATGTGTGAGGG - Intergenic
1049563219 8:143323828-143323850 GTGGGTGTGAACATGTGTGTAGG - Intronic
1050280968 9:4049582-4049604 CTATGTGTGCGCAAGTGTGTTGG - Intronic
1050951220 9:11597386-11597408 GTGTGTATGCGTGTGTGTGTGGG - Intergenic
1053003157 9:34589044-34589066 GTGTGTGTGCATGTGTGTGTCGG - Intronic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1055196122 9:73596342-73596364 CTTTGTGTGTATATGTGTGTAGG - Intergenic
1055289900 9:74771408-74771430 GTGTGTGTGCGCATGTGTGTAGG - Intronic
1055783812 9:79849804-79849826 CTGTTTATGCATCTGTGTTTAGG - Intergenic
1056186479 9:84140230-84140252 ATGTGTATACACATGTGTATAGG + Intergenic
1056315057 9:85380370-85380392 CTGTGTCTGCACATGGATGGAGG + Intergenic
1056460281 9:86802932-86802954 ATGTGTGTGCATGTGTGTGTGGG + Intergenic
1056768303 9:89458954-89458976 GTGTGTAGGCACATGTGTGTAGG - Intronic
1056768304 9:89458968-89458990 ATGAGTATGCATATGTGTGTAGG - Intronic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056926830 9:90842485-90842507 GTGTGTATGTGTATGTGTGTGGG + Intronic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057127799 9:92632892-92632914 CGGTGCATGCACATGTGGGGAGG + Intronic
1057440535 9:95079834-95079856 CTGTGTATCCACAGGTGTGTAGG - Intronic
1058112737 9:101049096-101049118 TTGTGTGTGCCCCTGTGTGTGGG + Intronic
1058321237 9:103634076-103634098 GTGTGTGTGCACGTGTGTGTAGG - Intergenic
1058420192 9:104826192-104826214 GTGGGTATGCGCATGTGTGTGGG - Intronic
1058818472 9:108707145-108707167 CTGTGTTTGCTCATTTTTGTCGG - Intergenic
1060162756 9:121381189-121381211 ATGTGTATGTATGTGTGTGTGGG + Intergenic
1060390170 9:123269944-123269966 CAGAGTATGCCCAGGTGTGTAGG + Intergenic
1060754801 9:126204742-126204764 CTATGTATGTATCTGTGTGTGGG + Intergenic
1060942210 9:127549470-127549492 GTGTGAGTGTACATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061416217 9:130448299-130448321 GTGTGCATGCACACGTGTGTGGG - Intronic
1061861373 9:133470221-133470243 GTGTGTATGTATATGTGTGTGGG + Exonic
1062025755 9:134339455-134339477 CTGTGTGTGAGCCTGTGTGTGGG + Intronic
1062057941 9:134478338-134478360 GTGTGTATGCTCGTGTGTGATGG + Intergenic
1062106802 9:134759607-134759629 GTATGTGTGCATATGTGTGTGGG - Intronic
1062107332 9:134763088-134763110 CTGTGTGTCCATGTGTGTGTAGG + Intronic
1062205968 9:135337557-135337579 AAGTGTATGCACATGTGTGCAGG + Intergenic
1062355775 9:136161371-136161393 GTGTGTGTGCATATGTGTGTGGG + Intergenic
1185480145 X:439799-439821 GTGTGTATGAATGTGTGTGTGGG - Intergenic
1185480192 X:440365-440387 ATGTGTGTGCACCTGTGTGTGGG - Intergenic
1185510091 X:657561-657583 CTGTTAATTCACCTGTGTGTGGG - Intronic
1185589818 X:1268537-1268559 GTGTGTGTGCACGTGTGTGCGGG + Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185764376 X:2713372-2713394 TTGTGTATGTGCATATGTGTAGG - Intronic
1185943679 X:4350364-4350386 GTGTGTGTGCATGTGTGTGTAGG + Intergenic
1185949176 X:4411921-4411943 CTGTATATGCATGTGTGTGAAGG - Intergenic
1186028138 X:5336765-5336787 GTGTATATGCATGTGTGTGTGGG - Intergenic
1186432531 X:9517303-9517325 CTGAGAATGCACAGGTGTATGGG - Intronic
1186719753 X:12290806-12290828 ATATGTATGCACATGTGTAGGGG - Intronic
1187161651 X:16770761-16770783 CTGTTGATGCACATTTGGGTTGG - Intergenic
1189363853 X:40373235-40373257 GTGTGTATGTGCATGTGTATAGG + Intergenic
1189364221 X:40375836-40375858 GTGTGTACACGCATGTGTGTGGG + Intergenic
1189549228 X:42076027-42076049 CTGTGTGTGTATGTGTGTGTGGG + Intergenic
1190254942 X:48755275-48755297 CTGTGTGTGTACATGTGGTTGGG - Intergenic
1190680328 X:52821096-52821118 GTGTGTGTGCACGTGTGGGTGGG - Intergenic
1192174308 X:68876243-68876265 CTGTGTGTGCACATGCTTGTAGG - Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1193990920 X:88306246-88306268 CTGTATACCCACAGGTGTGTGGG - Intergenic
1194006808 X:88504642-88504664 GTGTGTGTGCACGTGCGTGTAGG - Intergenic
1195029599 X:100913367-100913389 GTGTGTATGTGTATGTGTGTAGG - Intergenic
1197886189 X:131220767-131220789 CCGTGCATGCATGTGTGTGTGGG - Intergenic
1199571097 X:149268061-149268083 GTGTATATGCACCTCTGTGTAGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1199992008 X:152992827-152992849 CTGGGCAGGGACATGTGTGTGGG - Intronic
1200067900 X:153513328-153513350 ATGCGTGTGCATATGTGTGTGGG + Intergenic
1200235051 X:154464098-154464120 CTGGGTGTGCACATGTGTGCTGG + Intronic