ID: 1104931227

View in Genome Browser
Species Human (GRCh38)
Location 12:132340494-132340516
Sequence ACTCACCCACTGCCAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104931227_1104931238 19 Left 1104931227 12:132340494-132340516 CCCTCCCTTGGCAGTGGGTGAGT No data
Right 1104931238 12:132340536-132340558 CCCGGGATCCGTTCATCCCGTGG No data
1104931227_1104931233 1 Left 1104931227 12:132340494-132340516 CCCTCCCTTGGCAGTGGGTGAGT No data
Right 1104931233 12:132340518-132340540 CCGCCTACGGCTCTGCCTCCCGG No data
1104931227_1104931234 2 Left 1104931227 12:132340494-132340516 CCCTCCCTTGGCAGTGGGTGAGT No data
Right 1104931234 12:132340519-132340541 CGCCTACGGCTCTGCCTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104931227 Original CRISPR ACTCACCCACTGCCAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr