ID: 1104932584

View in Genome Browser
Species Human (GRCh38)
Location 12:132347650-132347672
Sequence CATGAAATGAACTCAGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104932584_1104932596 29 Left 1104932584 12:132347650-132347672 CCCGCTGCTGAGTTCATTTCATG No data
Right 1104932596 12:132347702-132347724 ATCCCGACACAGAGGAGCCGGGG No data
1104932584_1104932595 28 Left 1104932584 12:132347650-132347672 CCCGCTGCTGAGTTCATTTCATG No data
Right 1104932595 12:132347701-132347723 CATCCCGACACAGAGGAGCCGGG No data
1104932584_1104932587 -10 Left 1104932584 12:132347650-132347672 CCCGCTGCTGAGTTCATTTCATG No data
Right 1104932587 12:132347663-132347685 TCATTTCATGACAGACACCTGGG No data
1104932584_1104932590 21 Left 1104932584 12:132347650-132347672 CCCGCTGCTGAGTTCATTTCATG No data
Right 1104932590 12:132347694-132347716 GAGTCCCCATCCCGACACAGAGG No data
1104932584_1104932594 27 Left 1104932584 12:132347650-132347672 CCCGCTGCTGAGTTCATTTCATG No data
Right 1104932594 12:132347700-132347722 CCATCCCGACACAGAGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104932584 Original CRISPR CATGAAATGAACTCAGCAGC GGG (reversed) Intergenic
No off target data available for this crispr