ID: 1104939748

View in Genome Browser
Species Human (GRCh38)
Location 12:132389464-132389486
Sequence GAGGCAATTAACGTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104939748_1104939752 23 Left 1104939748 12:132389464-132389486 CCAGCAGCCACGTTAATTGCCTC No data
Right 1104939752 12:132389510-132389532 TATGAAAACAATCGGCATCCAGG No data
1104939748_1104939751 15 Left 1104939748 12:132389464-132389486 CCAGCAGCCACGTTAATTGCCTC No data
Right 1104939751 12:132389502-132389524 TGTTGCTGTATGAAAACAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104939748 Original CRISPR GAGGCAATTAACGTGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr