ID: 1104939953

View in Genome Browser
Species Human (GRCh38)
Location 12:132390391-132390413
Sequence TGGTTTCAGAAGATGAACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104939953_1104939959 5 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939959 12:132390419-132390441 CCCACGCTCCCTGGCACAAAAGG No data
1104939953_1104939955 -4 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939955 12:132390410-132390432 ACCAAGGACCCCACGCTCCCTGG No data
1104939953_1104939967 17 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939967 12:132390431-132390453 GGCACAAAAGGGCTCTGGGGAGG No data
1104939953_1104939968 26 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939968 12:132390440-132390462 GGGCTCTGGGGAGGCACAAATGG No data
1104939953_1104939962 12 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939962 12:132390426-132390448 TCCCTGGCACAAAAGGGCTCTGG No data
1104939953_1104939964 13 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939964 12:132390427-132390449 CCCTGGCACAAAAGGGCTCTGGG No data
1104939953_1104939966 14 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939966 12:132390428-132390450 CCTGGCACAAAAGGGCTCTGGGG No data
1104939953_1104939961 6 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104939953 Original CRISPR TGGTTTCAGAAGATGAACGC AGG (reversed) Intergenic
No off target data available for this crispr