ID: 1104939961

View in Genome Browser
Species Human (GRCh38)
Location 12:132390420-132390442
Sequence CCACGCTCCCTGGCACAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104939953_1104939961 6 Left 1104939953 12:132390391-132390413 CCTGCGTTCATCTTCTGAAACCA No data
Right 1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG No data
1104939952_1104939961 18 Left 1104939952 12:132390379-132390401 CCTGGAACATGGCCTGCGTTCAT No data
Right 1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104939961 Original CRISPR CCACGCTCCCTGGCACAAAA GGG Intergenic
No off target data available for this crispr