ID: 1104940751

View in Genome Browser
Species Human (GRCh38)
Location 12:132393569-132393591
Sequence TGGACGGGCGCTGACTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104940751 Original CRISPR TGGACGGGCGCTGACTCACC AGG Intergenic
900457335 1:2783626-2783648 TGGACGGGCGTTGGTGCACCTGG - Exonic
902228059 1:15009146-15009168 TGCCCGGGCACTGACTCCCCAGG + Intronic
919592513 1:199522066-199522088 GGGAAGGACTCTGACTCACCTGG + Intergenic
920443073 1:205994354-205994376 TGGAAGGGTGGTGACTCTCCAGG + Exonic
922794899 1:228335136-228335158 TGGATTGGCCCTGACACACCGGG + Exonic
1064274306 10:13892125-13892147 TGGACGCGCGCAGCCTCACCGGG - Intronic
1069639806 10:69947339-69947361 TGCAGGGGCTCAGACTCACCCGG - Exonic
1072044798 10:91644004-91644026 GGGTGGGGCGCTGCCTCACCCGG + Intergenic
1073694460 10:105849519-105849541 GGGTGGGGCGCTGCCTCACCCGG + Intergenic
1083869391 11:65477576-65477598 ACGCCGGGCGCTGAGTCACCGGG + Intergenic
1084784750 11:71435690-71435712 CGGATGGGCGCTGCCTCATCTGG - Exonic
1091205172 11:133815834-133815856 TGGACAGGCACTGAGTCTCCAGG + Intergenic
1102466960 12:113135639-113135661 CGGACGGGCGCTCCCTCCCCGGG - Intronic
1102546101 12:113656922-113656944 TGGTTGGGGGCTGACTCAGCTGG - Intergenic
1104940751 12:132393569-132393591 TGGACGGGCGCTGACTCACCAGG + Intergenic
1104940861 12:132394094-132394116 AGAACGGGTGCTGAGTCACCTGG + Intergenic
1105355023 13:19652292-19652314 GGGTCGGGCGTTGCCTCACCTGG + Intronic
1107964997 13:45589898-45589920 TGGAGGGGGGCTGCCTCGCCGGG + Intronic
1111281029 13:86025310-86025332 TTGATGGCTGCTGACTCACCAGG + Intergenic
1113936681 13:113998577-113998599 TGAAGGGGCACTGAGTCACCAGG + Intronic
1119147645 14:72331532-72331554 CGGCCGGGAGCTGCCTCACCTGG + Intronic
1120831186 14:88999239-88999261 TGGAAGGGCTCTCACTGACCAGG - Intergenic
1124178160 15:27446798-27446820 TGGAGGGCCACTGACTCCCCTGG - Intronic
1124994553 15:34710164-34710186 TTGACAGGCACTGACTCACCGGG + Intergenic
1125064660 15:35468381-35468403 GGGACGGTCTGTGACTCACCTGG - Intronic
1128812853 15:70585160-70585182 GGGACGGGCGCGGATTCGCCCGG - Intergenic
1129220280 15:74128384-74128406 TGGGCGGGAGCTGACTCCCGCGG - Exonic
1129702529 15:77775966-77775988 TGGATGGGCTGTAACTCACCAGG - Intronic
1132381670 15:101370584-101370606 TGGACGGGCGCTGGAGCTCCTGG - Intronic
1142213347 16:88818983-88819005 AGGAGGGGAGCTGACTCACCTGG - Intronic
1143341242 17:6213023-6213045 TGGACTGGCAGTGACTGACCTGG + Intergenic
1146908365 17:36632312-36632334 TGGCCGGGAGCTGGCTCTCCTGG - Intergenic
1151547182 17:74800285-74800307 TGCAAAGGCGCTCACTCACCAGG - Intronic
1151840668 17:76615212-76615234 TGGATGGGCGCCGGCTCAGCAGG - Intergenic
1153816469 18:8794526-8794548 TGGAGAGGCGCTGAGACACCCGG - Intronic
1157803135 18:50637065-50637087 TGGACGGGAGCTCAGTTACCTGG + Intronic
1161435106 19:4258420-4258442 TGGGCCGGCCCTGACTCACGCGG - Exonic
1161573087 19:5040958-5040980 TGGAAGTGCGCTGTCCCACCCGG + Intronic
1165559521 19:36667089-36667111 TCGGCGGGCGCGGACTAACCCGG + Intergenic
1166084207 19:40464559-40464581 TTGAGAGGCGCTGAGTCACCTGG - Intronic
1166733591 19:45071799-45071821 TGCACCGGCGCTCACACACCGGG - Exonic
1166796447 19:45428950-45428972 CCGCCGGGGGCTGACTCACCCGG + Intronic
1166855660 19:45781665-45781687 TGGGAGGGCGGTGACTCACGCGG - Intronic
932303514 2:70685468-70685490 TGGAGAAGCGCTGCCTCACCAGG - Intronic
933876224 2:86623721-86623743 GGGACGGGCGCTGAGTGGCCGGG - Exonic
934654621 2:96110725-96110747 TGGACGGGAGCTGTCTCAGCCGG - Intergenic
937666195 2:124489840-124489862 TTGAAGGGAGCTGACTCAGCTGG - Intronic
938068129 2:128292748-128292770 GGGAGGGGCGGTGACTCACAAGG + Intronic
938197172 2:129338526-129338548 AGGACAGGAGCTGACTCCCCAGG + Intergenic
942703007 2:178734919-178734941 TGGAGGCGTGCTGATTCACCTGG + Exonic
943692256 2:190881058-190881080 TGAGCGGGCGCTGACGGACCCGG + Exonic
948483808 2:238267492-238267514 TGTATGGAGGCTGACTCACCTGG + Intronic
948856598 2:240733070-240733092 TGGCCAGGCTCTGACCCACCTGG + Intronic
1172703351 20:36865418-36865440 TGGAGGAGCACTCACTCACCTGG - Intergenic
1176869975 21:14076363-14076385 AGGACGGTCCCTGACTCCCCCGG + Intergenic
1180091751 21:45537121-45537143 TGGACGTGGGCTTCCTCACCAGG + Intronic
1180240249 21:46498682-46498704 TGGACGAGCCCTGAATGACCCGG - Exonic
1185325344 22:50222801-50222823 TGGCTGGACGCTGACTCACCAGG - Intronic
953881292 3:46692736-46692758 GGGGCAGCCGCTGACTCACCTGG - Intronic
954294937 3:49669052-49669074 AGGACAGGCGGTGACTCACCTGG - Exonic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
991283318 5:64940391-64940413 GGGTGGGGCGCTGCCTCACCGGG - Intronic
997703321 5:135922374-135922396 TTGACGGCCGCTGACTGATCAGG + Intronic
1006929654 6:37680136-37680158 GGGTGGGGCGCTGACACACCAGG + Intronic
1017707910 6:157140809-157140831 TGGAAGGCCGCTGCCTCTCCCGG - Intronic
1017913904 6:158818280-158818302 GGGCGGGGCGCTGACTCACCCGG - Intronic
1022106560 7:27201149-27201171 TGGACCGGACCTGACTCTCCAGG + Intergenic
1034872895 7:154699577-154699599 TGCAGGGGCTCTGAGTCACCTGG + Intronic
1039869804 8:41536284-41536306 TGGACTTGGGCTGACTCACTGGG + Intronic
1061779376 9:132986775-132986797 AGCCCGGGCTCTGACTCACCCGG - Exonic
1195947371 X:110229694-110229716 GGGCGGGGCGTTGACTCACCCGG + Intronic
1201670663 Y:16516404-16516426 TGGGCGGGTGTTGCCTCACCCGG - Intergenic