ID: 1104944376

View in Genome Browser
Species Human (GRCh38)
Location 12:132409173-132409195
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944376_1104944386 23 Left 1104944376 12:132409173-132409195 CCCCTCAGTGAGCTCAGCGCAGG No data
Right 1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG No data
1104944376_1104944387 24 Left 1104944376 12:132409173-132409195 CCCCTCAGTGAGCTCAGCGCAGG No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944376_1104944380 -8 Left 1104944376 12:132409173-132409195 CCCCTCAGTGAGCTCAGCGCAGG No data
Right 1104944380 12:132409188-132409210 AGCGCAGGCCCAAGCACCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944376 Original CRISPR CCTGCGCTGAGCTCACTGAG GGG (reversed) Intergenic