ID: 1104944378

View in Genome Browser
Species Human (GRCh38)
Location 12:132409174-132409196
Sequence GCCTGCGCTGAGCTCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944378_1104944380 -9 Left 1104944378 12:132409174-132409196 CCCTCAGTGAGCTCAGCGCAGGC No data
Right 1104944380 12:132409188-132409210 AGCGCAGGCCCAAGCACCGCCGG No data
1104944378_1104944386 22 Left 1104944378 12:132409174-132409196 CCCTCAGTGAGCTCAGCGCAGGC No data
Right 1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG No data
1104944378_1104944387 23 Left 1104944378 12:132409174-132409196 CCCTCAGTGAGCTCAGCGCAGGC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944378 Original CRISPR GCCTGCGCTGAGCTCACTGA GGG (reversed) Intergenic