ID: 1104944378 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:132409174-132409196 |
Sequence | GCCTGCGCTGAGCTCACTGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1104944378_1104944380 | -9 | Left | 1104944378 | 12:132409174-132409196 | CCCTCAGTGAGCTCAGCGCAGGC | No data | ||
Right | 1104944380 | 12:132409188-132409210 | AGCGCAGGCCCAAGCACCGCCGG | No data | ||||
1104944378_1104944386 | 22 | Left | 1104944378 | 12:132409174-132409196 | CCCTCAGTGAGCTCAGCGCAGGC | No data | ||
Right | 1104944386 | 12:132409219-132409241 | CCGTCCACACCGTCCCCAGACGG | No data | ||||
1104944378_1104944387 | 23 | Left | 1104944378 | 12:132409174-132409196 | CCCTCAGTGAGCTCAGCGCAGGC | No data | ||
Right | 1104944387 | 12:132409220-132409242 | CGTCCACACCGTCCCCAGACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1104944378 | Original CRISPR | GCCTGCGCTGAGCTCACTGA GGG (reversed) | Intergenic | ||