ID: 1104944379

View in Genome Browser
Species Human (GRCh38)
Location 12:132409175-132409197
Sequence GGCCTGCGCTGAGCTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944379_1104944386 21 Left 1104944379 12:132409175-132409197 CCTCAGTGAGCTCAGCGCAGGCC No data
Right 1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG No data
1104944379_1104944387 22 Left 1104944379 12:132409175-132409197 CCTCAGTGAGCTCAGCGCAGGCC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944379_1104944380 -10 Left 1104944379 12:132409175-132409197 CCTCAGTGAGCTCAGCGCAGGCC No data
Right 1104944380 12:132409188-132409210 AGCGCAGGCCCAAGCACCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944379 Original CRISPR GGCCTGCGCTGAGCTCACTG AGG (reversed) Intergenic