ID: 1104944381

View in Genome Browser
Species Human (GRCh38)
Location 12:132409196-132409218
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944381_1104944387 1 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944381_1104944394 20 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944394 12:132409239-132409261 CGGGCCGCACCCCTGACGCAGGG No data
1104944381_1104944393 19 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944393 12:132409238-132409260 ACGGGCCGCACCCCTGACGCAGG No data
1104944381_1104944397 24 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944397 12:132409243-132409265 CCGCACCCCTGACGCAGGGAGGG No data
1104944381_1104944395 23 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944395 12:132409242-132409264 GCCGCACCCCTGACGCAGGGAGG No data
1104944381_1104944386 0 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944381 Original CRISPR CAGAGAAACCGGCGGTGCTT GGG (reversed) Intergenic