ID: 1104944383

View in Genome Browser
Species Human (GRCh38)
Location 12:132409204-132409226
Sequence GTGGACGGCAGAGAAACCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944383_1104944397 16 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944397 12:132409243-132409265 CCGCACCCCTGACGCAGGGAGGG No data
1104944383_1104944394 12 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944394 12:132409239-132409261 CGGGCCGCACCCCTGACGCAGGG No data
1104944383_1104944387 -7 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944383_1104944386 -8 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944386 12:132409219-132409241 CCGTCCACACCGTCCCCAGACGG No data
1104944383_1104944393 11 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944393 12:132409238-132409260 ACGGGCCGCACCCCTGACGCAGG No data
1104944383_1104944395 15 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944395 12:132409242-132409264 GCCGCACCCCTGACGCAGGGAGG No data
1104944383_1104944401 24 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944401 12:132409251-132409273 CTGACGCAGGGAGGGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944383 Original CRISPR GTGGACGGCAGAGAAACCGG CGG (reversed) Intergenic