ID: 1104944387

View in Genome Browser
Species Human (GRCh38)
Location 12:132409220-132409242
Sequence CGTCCACACCGTCCCCAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944379_1104944387 22 Left 1104944379 12:132409175-132409197 CCTCAGTGAGCTCAGCGCAGGCC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944382_1104944387 0 Left 1104944382 12:132409197-132409219 CCAAGCACCGCCGGTTTCTCTGC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944383_1104944387 -7 Left 1104944383 12:132409204-132409226 CCGCCGGTTTCTCTGCCGTCCAC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944381_1104944387 1 Left 1104944381 12:132409196-132409218 CCCAAGCACCGCCGGTTTCTCTG No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944376_1104944387 24 Left 1104944376 12:132409173-132409195 CCCCTCAGTGAGCTCAGCGCAGG No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944384_1104944387 -10 Left 1104944384 12:132409207-132409229 CCGGTTTCTCTGCCGTCCACACC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data
1104944378_1104944387 23 Left 1104944378 12:132409174-132409196 CCCTCAGTGAGCTCAGCGCAGGC No data
Right 1104944387 12:132409220-132409242 CGTCCACACCGTCCCCAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944387 Original CRISPR CGTCCACACCGTCCCCAGAC GGG Intergenic
No off target data available for this crispr