ID: 1104944693

View in Genome Browser
Species Human (GRCh38)
Location 12:132410370-132410392
Sequence CTCTGGGGCGTCCATCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944693_1104944699 5 Left 1104944693 12:132410370-132410392 CCTCCTTGATGGACGCCCCAGAG No data
Right 1104944699 12:132410398-132410420 CCCTATCCCCTCCCCAGCTCAGG 0: 2
1: 0
2: 9
3: 62
4: 619
1104944693_1104944701 6 Left 1104944693 12:132410370-132410392 CCTCCTTGATGGACGCCCCAGAG No data
Right 1104944701 12:132410399-132410421 CCTATCCCCTCCCCAGCTCAGGG No data
1104944693_1104944705 13 Left 1104944693 12:132410370-132410392 CCTCCTTGATGGACGCCCCAGAG No data
Right 1104944705 12:132410406-132410428 CCTCCCCAGCTCAGGGCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944693 Original CRISPR CTCTGGGGCGTCCATCAAGG AGG (reversed) Intergenic
No off target data available for this crispr