ID: 1104944721

View in Genome Browser
Species Human (GRCh38)
Location 12:132410467-132410489
Sequence CCGTGTTAAGGCGGCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104944721_1104944737 28 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944737 12:132410518-132410540 CCGAGGGTGGGGCCTCTGCAGGG No data
1104944721_1104944729 11 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944729 12:132410501-132410523 AGACCTGGAGCTGGGAGCCGAGG No data
1104944721_1104944725 -4 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944725 12:132410486-132410508 ACGGACTAATCCTGCAGACCTGG No data
1104944721_1104944727 3 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944727 12:132410493-132410515 AATCCTGCAGACCTGGAGCTGGG No data
1104944721_1104944733 16 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944733 12:132410506-132410528 TGGAGCTGGGAGCCGAGGGTGGG No data
1104944721_1104944732 15 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944732 12:132410505-132410527 CTGGAGCTGGGAGCCGAGGGTGG No data
1104944721_1104944735 27 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944735 12:132410517-132410539 GCCGAGGGTGGGGCCTCTGCAGG No data
1104944721_1104944730 12 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944730 12:132410502-132410524 GACCTGGAGCTGGGAGCCGAGGG No data
1104944721_1104944726 2 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944726 12:132410492-132410514 TAATCCTGCAGACCTGGAGCTGG No data
1104944721_1104944734 17 Left 1104944721 12:132410467-132410489 CCTCAGAAGCCGCCTTAACACGG No data
Right 1104944734 12:132410507-132410529 GGAGCTGGGAGCCGAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104944721 Original CRISPR CCGTGTTAAGGCGGCTTCTG AGG (reversed) Intergenic
No off target data available for this crispr